IAA7.1, IAA7.1 (gene) Malus x domestica

Gene Overview
Name IAA7.1
Gene Symbol IAA7.1
Type gene
Organism Malus x domestica
Synonym AUX/IAA7.1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IAA7.1DQ848597.1-IAA7.1Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IAA7.1DQ848597.1-IAA7.1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Indole acetic acid-induced proteinIAAMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ848597.1-IAA7.1 Chr10:28910616..28910956
chr10:19788260..19788600
chr10:22661711..22662051
DQ848597.1
predicted genes from whole genome assembly DQ848597.1-IAA7.1.m1 Chr10:28910616..28910956
chr10:19788260..19788600
chr10:22661711..22662051
DQ848597.1

Sequence(s):
>DQ848597.1-IAA7.1341
tgagctctctgatgccctagccaaaatgttcagctccttcaccattggtaactacttttatctatattttcaaaagatga
tttatgcacaattttgttaatttttatctctctaactgctaaaaataaataagagtacgtaaggagaaaaaagggtgtgc
ggagtcacctctcttatatttttggaacaagttaatgcattatttgtctgttaaattttcaattattatgatacttggag
taatggtataaaattttcaatcattgaaggaaattgtggatcccaaggaatgaaggacttcatgaatgagagaaagctga
tggatgtttctcaacggttct
back to top
>DQ848597.1-IAA7.1.m1119
tgagctctctgatgccctagccaaaatgttcagctccttcaccattggaaattgtggatcccaaggaatgaaggacttca
tgaatgagagaaagctgatggatgtttctcaacggttct
back to top