IAA, IAA (gene) Malus x domestica

Gene Overview
Name IAA
Gene Symbol IAA
Type gene
Organism Malus x domestica
Synonym AUX/IAA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IAADQ848609.1-IAA.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Indole acetic acid-induced proteinIAAMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ848609.1-IAA.m1 Chr02:4632832..4633407
chr2:4852943..4853518
chr2:4838859..4839434
DQ848609.1

Sequence(s):
>DQ848609.1-IAA.m1237
gtgagtatggatggtgctccgtacmtgaggaaagttgatctcaaaacctatggcagctatctggatttatctctagctct
ggaaaagatgttcagctgcttcacaattggtcaatgtggttcacatggagcttcaagggatggattgagcgagagtcgat
tgatggacctcctacatggtgctgaatatgtcctcacctatgaagacaaggatggtgagtggatgctcgttggtgat
back to top