IPT1A, IPT1A (gene) Malus x domestica

Gene Overview
Name IPT1A
Gene Symbol IPT1A
Type gene
Organism Malus x domestica
Synonym adenylate isopentenyltransferase
Description NA
Comment cytokinin biosynthesis enzyme
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT1AHQ585951.1-IPT1A.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HQ585951.1-IPT1A.m1 Chr13:2775657..2776770
chr13:2401773..2402886
chr13:2411044..2412157
chr13:2388066..2389179
HQ585951.1

Sequence(s):
>HQ585951.1-IPT1A.m11113
atgacacttcatgccttcccaactcactccctccattattctaatctcaatttcaatacgaattatatcttccaccgctt
caacttgttcccgccgctccaccacctctacaaccaccccactcctccgcttcacctcccccaaaggccccgccgctcgg
cccacatggccaccggccccacctccgctggcccacgaagaaaagacaagcttctcgtcatcatgggggccaccggcgct
ggcaagtcccgcctctccctcgacctcgccagccgcttccccttcttcgaaatcgtcaactccgacaaaatacaactcta
ccgcggcctagacatcaccaccaacaagctccccctaccggaacgactcggcgtcccccaccacctcctcggcgagttcg
accccctagacggcgacttcacccccgccgattttcgcgccgtcgccggtcaggttgtttccggcattaccaatcggagg
aaggtgccgatgctcgtaggcgggtcaaactccttcattcacgcgatggtcgcggaacggttcgaaccgggctccaatgt
cttcgaaccgggtttcgacgcctccgtctcggccgagctcaggtacaattgctgttttctttgggtggacgtgtcgatgg
cggtgttgacggagtatttatcaaagcgagtcgacgaaatgctcgactcgggaatgttcgacgagttggcagagttttgc
gacccggatcgccaggacaagaaggacccagctgcggttccgacagggttgagaaaggcgattggagtgcccgagttcac
tcggtattttaaaaaatacccacaaagtaaaagagacgaggacgacgaccgggagcggagaggagcatacgaagaggcgg
tgagggtgatcaaggacaacacgtgtcagctggcgaagaggcagatagggaagatcctacggttaagagggggagggtgg
gacttacggagactagacgcaacggacgcgtttagggcggtggttgcgacgtcgacgccggaaaatgacggcggagagag
gtggtcagagatatgggagcggcaggtggtggaaccaagcgcgaagattgtgaagcgcttcttggaggagtag
back to top