IPT3A, IPT3A (gene) Malus x domestica

Gene Overview
Name IPT3A
Gene Symbol IPT3A
Type gene
Organism Malus x domestica
Synonym adenylate isopentenyltransferase
Description NA
Comment cytokinin biosynthesis enzyme
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT3AHQ585947.1-IPT3A.m1Malus x domesticamRNA
IPT3AHQ606061.1-IPT3A.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HQ585947.1-IPT3A.m1 Chr03:35283548..35284511
chr3:31482981..31483944
chr3:37001354..37002317
HQ585947.1
predicted genes from whole genome assembly HQ606061.1-IPT3A.m1 Chr03:35283548..35284511
chr3:31482981..31483944
chr3:37001354..37002317
HQ606061.1

Sequence(s):
>HQ585947.1-IPT3A.m1963
atgatgccaatgtgcaaacaaatacaaacattactacatgttccatctagtggccataatcataaaatggacgtgttcaa
tcctcaccggcagaaggagaaggtggtgatcgtaatgggagcaacagggaccggaaagtcaaggctctccatcgacctag
ccacctgtttcccggcagaaatcataaactccgacaaaatgcaagtctacgaaggccttgacatagtcaccaacaaaata
accaaagaagagcaacgtggtgtaccgcaccatttgctagggatgctagatcctcatgaagattttactgccagggattt
ttgtgacctaacctcaattgccattgaatccattttaggccgtgatcggcttccaatcatcgttggaggttccaactctt
acatcgaggcgttgatcgatgattatgactataaatttcggtccaagtatgactgttgctttttatgggtagatgtgtct
acacccgttctgcactcttttgtgtcaaaacgggtagaccacatggttcaaaacggaatggtggatgaggcgagagagta
ctttgatcccaatgcagattacacgaaagggattcgaagagcaataggggtccctgaattcgataagtacttcaggtatg
ggccatttttggaagaagaaactcgtgctcggttactacgacaagcagtggacgaaattaaggacaatacgtgcaaattg
gcatgtcgacaactggagaagattcatagacttagaaatatcaaagggtggaatctgcacccgttggatgccacggaggt
gttccgaaagcgcggcgaagaggccgacgaggcctggaaaaagcttgtgtcggggacaagtgctatgatcgttggccagt
ttctttacaatatgacagctgaggttcctccacatcttggaagccttagggttcttgaagcacttgcagctgcaactcac
tag
back to top
>HQ606061.1-IPT3A.m1963
atgatgccaatgtgcaaacaaatacaaacattacaacatgttccatctagtggccataatcataaaatcgacgtgttcaa
tcctcaccggcagaaggagaaggtggtgatcgtaatgggagcaacagggaccggaaagtcaaggctctccatcgacctag
ccacctgtttcccggcagaaatcataaactccgacaaaatgcaagtctacgaaggccttgacatagtcaccaacaaaata
accaaagaagagcaacgtggtgtaccgcaccatttgctagggatgctagatcctcatgaagattttactgccagggattt
ttgtgacctaacctcaattgccattgaatccattttaggccgtgatcggcttccaatcatcgttggaggttccaactctt
acatcgaggcgttgatcgatgattatgactataaatttcggtccaagtatgactgttgctttttatgggtagatgtgtct
acacccgttctgcactcttttgtgtcaaaacgggtagaccacatggttcacaacggaatggtggatgaggcgagagagta
ctttgatcccaatgcagattacacgaaagggattcgaagagcaataggggtccctgaattcgataagtacttcaggtatg
ggccatttttggatgaagaaactcgtactcggttactacgacaagcagtggacgaaattaaggacaatacgtgcaaattg
gcatgtcgacaactggagaagattcatagacttagaaatatcaaagggtggaatctgcacccgttggatgccacggaggt
gttccgaaagcgcggcgaagaggccgacgaggcctggaaaaagcttgtgtcggggacaagtgctatgatcgttggccagt
ttctttacaatatgacagctgaggttcctccacatcttggaagccttagggttcttgaagcacttgcagctgcaactcac
tag
back to top