IPT3B, IPT3B (gene) Malus x domestica

Gene Overview
Name IPT3B
Gene Symbol IPT3B
Type gene
Organism Malus x domestica
Synonym adenylate isopentenyltransferase
Description NA
Comment cytokinin biosynthesis enzyme
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT3BHQ585948.1-IPT3B.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HQ585948.1-IPT3B.m1 Chr11:40838724..40839651
chr11:33042380..33043307
chr11:37611872..37612799
HQ585948.1

Sequence(s):
>HQ585948.1-IPT3B.m1927
atgttccattctagtggccataatcatagaatggatgtgttcaatccccgccggcagaaggagaaggtggtgatcgtaat
gggggcaacggggaccggaaaatcaaggctctccatcgacctagccacctgtttcccggcagaaatcataaactccgaca
aaatgcaagtctacgaaggccttgatatagtcaccaacaaaataaccaaagaagagcaacgtggtgtaccgcaccatttg
ctagggatactagatcctaatgaagattttacagccagggatttttgtgacctaacctcacttgccattgaatctgtttt
aggccgtgatcggcttccaatcatcgtcggaggctccaactcctacatcgaggcgttagtcgatgaccatgactataaat
ttcggtctaagtacgaatgttgctttttatgggtggatgtttctgtacccgttatgcactcgtttgtgtcaggacgggtt
gaccacatggttcaaaatggaatggtggatgaggcgagagagttctttgatcccaatgcagattacatgaaagggattcg
aagggcaattggggtccctgaattcgataagtacttcaggtatgggccacttttggatgaagaaactcgtgccaggttac
tacaacaagcagtggacaaaattaaggacaatacgtgcaaattggcatgccgacaattggagaagattcatggacttaga
aataacaaagggtggaatctgcacccgttggatgccaccgaggtgttccgaaagcgcggcaaggacgctgacgaggcctg
ggaaaagcttgtgtcggggccaggtgctatgatcgttggccagtttctttacaatatgacagctgaggttcctccacata
ttggaagtcttagggttcctgcagcacttgcagctgcaactcactag
back to top