IPT3, IPT3 (gene) Rosa hybrid cultivar

Gene Overview
Name IPT3
Gene Symbol IPT3
Type gene
Organism Rosa hybrid cultivar
Synonym IPT3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT3KJ933389.1-IPT3.m1Rosa hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTRosa hybrid cultivargene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KJ933389.1-IPT3.m1 N/A KJ933389.1

Sequence(s):
>KJ933389.1-IPT3.m1993
atgaacatgatgccaatgtgcaaacaaactcagacgttaccaaacgttccactgtccattggcggcgggcacagccacaa
cctcctcgatgtgttgaatgtccaccgccagaaggataaggtggtgatcgtaatgggcgccaccgggacgggcaagtcaa
agctctccatcgacctggccacccgcttcccggccgaaatcatcaactccgacaaaatgcaactctacgagggccttgac
atcgccaccaacaaaatatcacctcaagaacaacgcggcgtcccccaccatttgcttggagttttagaccccaatgcgga
tttctctgccgacgacttctgtggcatcacctgcctcgcagtcgagtcgatcttaaaccgcgaccggcttccaatcatcg
ttggaggttcgaactcgtacatagaggcgttgatcgacggctacgataagatgttccggtcaagatatgactgctgcttt
ctctgggtggatgtatccttacccgttttgcaatcttttgtttccgaccgggtcgatcagatggtggagaatggaatggt
ggaggaggtgagagagttctttgatccgaaagcggattatacaaaagggatcagaagggctatcggtgtgccggagtttg
atgactttttccggtatggtccgtctttggatgaggaaactagagcctggttacttgaacaagcgataaatgaagtaaaa
gacaatacatgcaagttggcatgtaggcaattggagaagattcgaagacttaggaataaagggtggagtctgcatccact
tgatgccactgaggtgttccggaagcgtggcaaggaggctgatgaggcctgggacaggctggtttcggggccaagcgcag
tgattgttcgccaatttctttacaatgtcaaggccgaagttcccacaaatctcactgccatcagggttccggccgcaatg
gaaactgcagcccttgcagctgcaacttactag
back to top