GAPDH, KF562857.1-GAPDH.m1 (mRNA) Rosa odorata var. gigantea

Transcript Overview
Unique NameKF562857.1-GAPDH.m1
OrganismRosa odorata var. gigantea ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHKF562857.1-GAPDHRosa odorata var. giganteagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa odorata var. giganteagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KF562857.1-GAPDH.m1-cds1KF562857.1-GAPDH.m1-cds1Rosa odorata var. giganteaCDS
KF562857.1-GAPDH.m1-cds2KF562857.1-GAPDH.m1-cds2Rosa odorata var. giganteaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GAPDHKF562857.1-GAPDH.p1Rosa odorata var. giganteapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KF562857 region KF562857:64..401+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productglyceraldehyde 3-phosphate dehydrogenase
The following sequences are available for this feature:

mRNA sequence

>KF562857.1-GAPDH.m1 ID=KF562857.1-GAPDH.m1|Name=GAPDH|organism=Rosa odorata var. gigantea|type=mRNA|length=228bp
back to top

protein sequence of GAPDH

>KF562857.1-GAPDH.p1 ID=KF562857.1-GAPDH.p1|Name=GAPDH|organism=Rosa odorata var. gigantea|type=polypeptide|length=76bp
back to top

mRNA from alignment at KF562857:64..401+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KF562857.1-GAPDH.m1 ID=KF562857.1-GAPDH.m1|Name=GAPDH|organism=Rosa odorata var. gigantea|type=mRNA|length=338bp|location=Sequence derived from alignment at KF562857:64..401+ (Rosa odorata var. gigantea)
gctgtcggaaaggtactgcctgctctcaatggcaagttgactggaatggc cttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagac ttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggc ttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcac attacaatgcgtgtcttggttctaatcttttatctttaattctgtctgaa tagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatg aggatgttgtgtcaacagacttcattggtgacaacagg
back to top

Coding sequence (CDS) from alignment at KF562857:64..401+

>KF562857.1-GAPDH.m1 ID=KF562857.1-GAPDH.m1|Name=GAPDH|organism=Rosa odorata var. gigantea|type=CDS|length=228bp|location=Sequence derived from alignment at KF562857:64..401+ (Rosa odorata var. gigantea)
back to top