IPT7A, IPT7A (gene) Malus x domestica

Gene Overview
Name IPT7A
Gene Symbol IPT7A
Type gene
Organism Malus x domestica
Synonym adenylate isopentenyltransferase
Description NA
Comment cytokinin biosynthesis enzyme
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPT7AHQ585953.1-IPT7A.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HQ585953.1-IPT7A.m1 Chr00:16949198..16950053
chr6:5106679..5107534
chr6:7224281..7225136
chr6:5896277..5897132
chr6:8409210..8410065
HQ585953.1

Sequence(s):
>HQ585953.1-IPT7A.m1855
atggaacctgtgcatgtcaatggttctgtccacaaaaaggcgaaggttgtttttataatgggtccgactgggtgtggaaa
aaccaaactttccatagacctagctaccaattacgggggagaagtaattaattcggacaaaatccaagtctacaaaggcc
tggacattgtcactaacaaagccacagaatctgagcaacgaggcatccgtcatcacttgctagggttcgtagaagacccc
gtagctgatttctccgttgatgaatttcgtcgtcgtgtgcaaacttcaatcgatgagatcacaaagcgtaactgcctccc
aatcattgctggcggatccaactcttatatcgaggcactcatcgaagatccagtgattgattttcgaaataaatatgatt
gctgttttatatggcttgatgtgtcgttgcctgtgctatataaccatgtgtccaaaagagttgacgaaatggtggctgca
ggattagtggatgagcttcgtgaaatgtttgctccaggggtgaattatgatggtggcattcgccgagcaatcggagctcc
ggagatgcatccgtacttcatggctgaaatgaacaacaatatagtagacgatgacaaggttcgtaaggaatttctgctga
aagatggcatttggaaaaccaaagaaaatacttgtaaacttgctgaacgccaagtgcagaaaattaaacttctcagcgac
aaatgggatattcatcgtattgatgtcactgctgtgtatgagaactgtggaaaggaagctgtggttgcctgggaaacctt
ggttttaaagccaagtttcaccattgtgggtggatttttgaagaaacatggttga
back to top