IPT, IPT (gene) Malus x domestica

Gene Overview
Name IPT
Gene Symbol IPT
Type gene
Organism Malus x domestica
Synonym isopentenyltransferase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPTGU183552.1-IPT.m1Malus x domesticamRNA
IPTGU136289.1-IPT.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly GU183552.1-IPT.m1 Chr13:15366565..15367576
chr13:17680852..17681863
chr13:19721647..19722658
GU183552.1
predicted genes from whole genome assembly GU136289.1-IPT.m1 Chr03:13674109..13677524
chr3:13026649..13030064
chr3:14557936..14561351
GU136289.1

Sequence(s):
>GU183552.1-IPT.m11011
atgagaattctcatgtctgcctgcaaacaagtagtacagccgatggtgagcttccaaggccccgggctcaccaacataaa
catggatccgtttttacggcgaaaagataaggttgtgatcgtaatgggagccaccgggactggcaagtcccggcttgcca
tagacctcgcaagacataatccgccggcggagattattaactcggacaaaatgcaagtctacaaaggcttggacatcgtc
accaacaaagtcactgaggacgagtgtaaaggcatacctcaccatttgataggcaaagtcgatcccgactcagattttac
tgccaatgatttcaagcaccatgcgtcgttggccatcgaatcgatcttggagcgtgacagattgccaatcattgccgggg
gttcaaattcgtatattgaagccttggtggatgaacactcggagtttcgaatgaagtacgagtgttgctttctttgggtt
gatgtggccatccccgtgctccactctttcgtgtcagagagagtggaccggatggtgaagatgggtttggttgaagaggt
gaggagaatgtttgactctacaactgagaaagaatatacgcgcggagtcaggcgagccataggcgtgcctgaaatggatg
agtatttacaaggcgaagcaagtgataataacgatgatgaaactcaagagaggcttcttcaagcagcaatttctaaaatc
aaagaaaatacttgcattttggcgtatcgccaattgcaaaagattcgccggctgcaagctcggcggggttggaacatgca
ccgccttgatgccacggaggcgttcttaaagcaccacgcggaaacgaatcaagcgtgggaaaaactcgtggcaagacctg
ccacgcggatagtgcgtcagttccttttggacccaattccctccattcttccgacagagaatatcaccgccactaccacc
gctccggttctttccacgtctatgccgacagtgaccgctgcaacacgatag
back to top
>GU136289.1-IPT.m1648
atggaaagcagtgacgctgccattgaaacccagagaccccaaaaccatgaacccattgaagagaagccgaaggtggtggt
gataatgggacccacaggctcagggaagtcaaagctggccattgatttggcatcccacttccccgtggaggtcatcaacg
ctgattctatgcaggtctacagtggcttggatgttctcaccaacaaggtccctctgcacgaacaaaaaggagtggctcat
catctgctgggaactgtaagcccgaatgttgaattcacagcgaaagagtttcgggactctgccattcctctcatcaatga
catattatctcgcaactgcttgccggtcatagttggtggtaccaattactatatccaggctcttgttagtccattccttt
tagacgaaacagtagaagatattgatgaatgctgtttaggtgattatccaggagatggacaaccacaggctgagctggtt
attgaagtagacaattccagttatgactatgactatcttaaagccattgatccagttgcagcaaacagaatccatccaaa
gaaccatagaaaagtaagtttgtggcataatatgtactgtcgtcttgctgaatatatagtatgtgatgattttaaaatct
tttactag
back to top