IPT, IPT (gene) Malus hupehensis

Gene Overview
Name IPT
Gene Symbol IPT
Type gene
Organism Malus hupehensis
Synonym isopentenyltransferase
Description NA
Comment MhIPT
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
isopentenyltransferaseIPTMalus hupehensisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IPTDQ792508.1-IPT.m1Malus hupehensismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ792508.1-IPT.m1 Chr03:35283548..35284511
chr3:31482981..31483944
chr3:37001354..37002317
DQ792508.1

Sequence(s):
>DQ792508.1-IPT.m1963
atgatgccaatgtgcaaacaaatacaaacattactacatgttccatctagtggccataatcataaaatggacgtgttcaa
tcctcaccggcagaaggagaaggtggtgatcgtaatgggagcaacagggaccggaaagtcaaggctctccatcgacctag
ccacctgtttcccggcagaaatcataaactccgacaaaatgcaagtctacgaaggccttgacatagtcaccaacaaaata
accaaagaagagcaacgtggtgtaccgcaccatttgctagggatgctagatcctcatgaagattttactgccagggattt
ttgtgacctaacctcaattgccattgaatccattttaggccgtgatcggcttccaatcatcgttggaggttccaactctt
acatcgaggcgttgatcgatgattatgactataaatttcggtccaagtatgactgttgctttttatgggtagatgtgtct
acacccgctctgcactcttttgtgtcaaaacgggtagaccacatggttcaaaacggaatggtggatgaggcgagagagta
ctttgatcccaatgcagattacacgaaagggattcgaagagcaataggggtccctgaattcgataagtacttcaggtatg
ggccatttttggaagaagaaactcgtgctcggttactacgacaagcagtggacgaaattaaggacaatacgtgcaaattg
gcatgtcggcaactggagaagattcatagacttagaaatatcaaagggtggaatctgcacccgttggatgccacggaggt
gttccgaaagcgcggcgaagaggccgacgaggcctggaaaaagcttgtgtcggggacaagtgctatgatcgttggccagt
ttctttacaatatgacagctgaggttcctccacatcttggaagccttagggttcttgaagcacttgcagctgcaactcac
tag
back to top