KAO, KAO (gene) Malus x domestica

Gene Overview
Name KAO
Gene Symbol KAO
Type gene
Organism Malus x domestica
Synonym ent-kaurenoic acid oxidase
Description NA
Comment catalyzes ent-kaurenoic acid to ent-7-hydroxykaurenoic acid; rate-limiting enzyme
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
KAOKC433941.1-KAO.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
ent-kaurene oxidaseKAOMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly KC433941.1-KAO.m1 Chr02:27306302..27311146
chr2:26788990..26793838
KC433941.1

Sequence(s):
>KC433941.1-KAO.m11512
atggtgctgggtttggtggtgggtgtgggaacggggctggcttccatttggatgttacttctgtcgagctttgttggtct
tgtggccttctggtggcttatcaagaatgcaaatcggttgctgtatgaaacgcagctgggtgaaaggcagtactccctcc
cacctggtgacttgggcttgcctttcattggcaacatgtggtccttcctcagagctttcaaatctaacaatcctgagtcc
tttctcgacaagtttgtttccagatttgggaaaactggaatctacaaggccttcatgttcgggttcccaagtatcattgt
tacaacgcctgaaacaagtaaaagagttttgactgacgacgatgcattcaaacccgggtggcctgtttctactgtggagc
taattggaaagaaatcattcataggtatatcttacgaagaacacaaacgtctaaggagactaacagcagctccagtcaat
ggtcacgaagcattgtctgtgtacatgaagtacattgaagagattgtcataacgtccttggaaaaatggtccaaactggg
acaaatagagttcttaactcaactcagaaagcttaccttcaagattattatgtacatctttcttagctcagagagcgagc
cagtcatggaggctttggagagggaatatacagtacttaactacggagttagagccatggcaatcaatcttccgggattt
gcataccataaagcacttaaggctcggaaaaatcttgttgctatatttcaatcaattgtggatgagcgaagagctcaaag
aaagtccggaaactactatgtaaagaagaaagatatgatggacgctctgctggatgttgaggatgacgatggaagaaaac
ttaacgatgaggacattatagacgtactgctaatgtacttgaatgcaggccatgaatcttctggccataccataatgtgg
gctaccgttttcctacaagcaaacccagaagctttccagagagctaaggctgagcaagaggagattctcaagaggaggcc
accaacgcagaagggcttaacactcaaggaatatcgagaaatggactatctttcccaggtgatagatgaaactcttcgcg
tgataacattctcactcaccgtctttcgagaggcaaagaaggatgtcaaaataaacggttatagcattcccaagggctgg
aaagtattggtttggttcaggagcattcactatgattctgaattatatccaaacccaacggaattcaacccttccagatg
ggataatcacacaccaaaagcattaagttttcttccctttggagctggaagccatctgtgccccggaaatgatcttgcta
agctggaaatagctattttccttcaccatttcctccttaattataagatggaacgcactaatccgggatgccccttgatg
tacttgcctcatactaggcctaaagacaattgcgtggcaaaaatcaagaaatgtggatctgcaggggcatga
back to top