LAR1, LAR1 (gene) Malus x domestica

Gene Overview
Name LAR1
Gene Symbol LAR1
Type gene
Organism Malus x domestica
Synonym leucoanthocyanidin reductase 1
putative leucoanthocyanidin reductase
Description NA
Comment LAR1
MdLAR1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LAR1JX892951.1-LAR1.m1Malus x domesticamRNA
LAR1JX892957.1-LAR1.m1Malus x domesticamRNA
LAR1JX892954.1-LAR1.m1Malus x domesticamRNA
LAR1DQ139836.1-LAR1.m1Malus x domesticamRNA
LAR1AY830131.1-LAR1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
leucoanthocyanidin reductaseLARMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JX892951.1-LAR1.m1 Chr16:3405164..3409492
chr16:1535954..1540282
chr16:1536039..1540362
chr16:1538298..1542490
chr16:1535954..1540282
JX892951.1
predicted genes from whole genome assembly JX892957.1-LAR1.m1 Chr16:3405164..3409492
chr16:1535954..1540282
chr16:1536039..1540362
chr16:1538298..1542490
chr16:1535954..1540282
JX892957.1
predicted genes from whole genome assembly JX892954.1-LAR1.m1 Chr16:3405164..3409492
chr16:1535954..1540282
chr16:1536039..1540362
chr16:1538298..1542490
chr16:1535954..1540282
JX892954.1
predicted genes from whole genome assembly DQ139836.1-LAR1.m1 Chr16:3405164..3409492
chr16:1535954..1540282
chr16:1536039..1540362
chr16:1538298..1542490
chr16:1535954..1540282
DQ139836.1
predicted genes from whole genome assembly AY830131.1-LAR1.m1 Chr16:3405164..3409492
chr16:1535954..1540282
chr16:1536039..1540362
chr16:1538298..1542490
chr16:1535954..1540282
AY830131.1

Sequence(s):
>JX892951.1-LAR1.m11065
atgaccgtttcatcttctctttctgttgccaaaaatggcagagtcctcatcgccggtgccaccggtttcatcgggaggtt
cgtagctgaagccagcctcgcagccggtcaacccacgtatgttctcgtccggcccggccctctgcgcccttctaaggctg
acaccgtcaagtccttcaaagacaaaggcgcaataatcttacacgggctgatttccgataaaaccctaatggagaaaatg
ctaagagagcatgaaatcgagatagtaatatcagccgtgggtggtgccacaatattggaccagatcaccctagtcgacgc
cattgcggcagttggtacagttaagaggtttttgccgtcggagtttggacacgatgtggacagggctgatccggtggaac
cagggctcaccatgtatttggagaaacgcaaggttagacgttccgtcgagacatctggggtaccctacacatatatttgc
tgcaactcgattgcttcttggccctactttgacaacacccacccttctgaggttctcccaccgttggatcggttccaaat
ctacggtgatggcaccgtcaaagcctactttgtagacggtacggatatcgggaagttcacaatgaaaacggtggacgaca
tgcgaacaatcaacaaaaatgttcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatccctgtgggag
aagaaaattggccggaccctccctagagtcaccgtcactgaagatcacctactagcccttgctgcagataaccgtatacc
agaaagcattgtggcctcgttcacgcatgacatctttatcaaaggatgccaggttaattttgcagtggaagggcctcatg
atgtggaagtgggaactctctaccctggagattctttcaggaccttggatgagtgcttcgatggctttcttctcaagttg
aaggacaacctagagctagagctactgcaagaggaggaggatcagaaagtctccaccgaaaacaccgttgtcgaatccag
gactgtcactgccacttgtgcttga
back to top
>JX892957.1-LAR1.m11065
atgaccgtttcatcttctctttctgttgccaaaaatggcagagtcctcatcgccggtgccaccggtttcatcgggaggtt
cgtagctgaagccagcctcgcagccggtcaacccacgtatgttctcgtccggcccggccctctgcacccttctaaggctg
acaccgtcaagtccttcaaagacaaaggcgcaataatcttacacgggctgatttccgataaaaccctaatggagaaaatg
ctaagagagcatgaaatcgagatagtaatatcagccgtgggtggtgccacaatattggaccagatcaccctagtcgacgc
cattgcggcagttggtacagttaagaggtttttgccgtcggagtttggacacgatgtggacagggctgatccggtggaac
cagggctcaccatgtatttggagaaacgcaaggttagacgttccgtcgagacatctggggtaccctacacatatatttgc
tgcaactcgattgcttcttggccctactttgacaacacccacccttctgaggttctcccaccgttggatcggttccaaat
ctacggtgatggcaccgtcaaagcctactttgtagacggtacggatatcgggaagttcacaatgaaaacggtggacgaca
tgcgaacaatcaacaaaaatgttcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatccctgtgggag
aagaaaattggccggaccctccctagagtcaccgtcactgaagatcacctactagcccttgctgcagataaccgtatacc
agaaagcattgtggcctcgttcacgcatgacatctttatcaaaggatgccaggttaattttgcagtggaagggcctcatg
atgtggaagtgggaactctctaccctggagattctttcaggaccttggatgagtgcttcgatggctttcttctcaagttg
aaggacaacctagagctagagctactgcaagaggaggaggatcagaaagtctccaccgaaaacaccgttgtcgaatccag
gactgtcactgccacttgtgcttga
back to top
>JX892954.1-LAR1.m11065
atgaccgtttcatcttctctttctgttgccaaaaatggcagagtcctcatcgccggtgccaccggtttcatcgggaggtt
cgtagctgaagccagcctcgcagccggtcaacccacgtatgttctcgtccggcccggccctctgcacccttctaaggctg
acaccgtcaagtccttcaaagacaaaggcgcaataatcttacacgggctgatttccgataaaaccctaatggagaaaatg
ctaagagagcatgaaatcgagatagtaatatcagccgtgggtggtgccacaatattggaccagatcaccctagtcgacgc
cattgcggcagttggtacagttaagaggtttttgccgtcggagtttggacacgatgtggacagggctgatccggtggaac
cagggctcaccatgtatttggagaaacgcaaggttagacgttccgtcgagacatctggggtaccctacacatatatttgc
tgcaactcgattgcttcttggccctactttgacaacacccacccttctgaggttctcccaccgttggatcggttccaaat
ctacggtgatggcaccgtcaaagcctactttgtagacggtacggatatcgggaagttcacaatgaaaacggtggacgaca
tgcgaacaatcaacaaaaatgttcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatccctgtgggag
aagaaaattggccggaccctccctagagtcaccgtcactgaagatcacctactagcccttgctgcagataaccgtatacc
agaaagcattgtggcctcgttcacgcatgacatctttatcaaaggatgccaggttaattttgcagtggaagggcctcatg
atgtggaagtgggaactctctaccctggagattctttcaggaccttggatgagtgcttcgatggctttcttctcaagttg
aaggacaacctagagctagagctactgcaagaggaggaggatcagaaagtctccaccgaaaacaccgttgtcgaatccag
gactgtcactgccacttgtgcttga
back to top
>DQ139836.1-LAR1.m11065
atgaccgtttcatcttctctttctgttgccaaaaatggcagagtcctcatcgccggtgccaccggtttcatcgggaggtt
cgtagctgaagccagcctcgcagccggtcaacccacgtatgttctcgtccggcccggccctctgcacccttctaaggctg
acaccgtcaagtccttcaaagacaaaggcgcaataatcttacacgggctgatttccgataaaaccctaatggagaaaatg
ctaagagagcatgaaatcgagatagtaatatcagccgtgggtggtgccacaatattggaccagatcaccctagtcgacgc
cattgcggcagttggtacagttaagaggtttttgccgtcggagtttggacacgatgtggacagggctgatccggtggaac
cagggctcaccatgtatttggagaaacgcaaggttagacgttccgtcgagacatctggggtaccctacacatatatttgc
tgcaactcgattgcttcttggccctactttgacaacacccacccttctgaggttctcccaccgttggatcggttccaaat
ctacggtgatggcaccgtcaaagcctactttgtagacggtacggatatcgggaagttcacaatgaaaacggtggacgaca
tgcgaacaatcaacaaaaatgttcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatccctgtgggag
aagaaaattggccggaccctccctagagtcaccgtcactgaagatcacctactagcccttgctgcagataaccgtatacc
agaaagcattgtggcctcgttcacgcatgacatctttatcaaaggatgccaggttaattttgcagtggaagggcctcatg
atgtggaagtgggaactctctaccctggagattctttcaggaccttggatgagtgcttcgatggctttcttctcaagttg
aaggacaacctagagctagagctactgcaagaggaggaggatcagaaagtctccaccgaaaacaccgttgtcgaatccag
gactgtcactgccacttgtgcttga
back to top
>AY830131.1-LAR1.m11065
atgaccgtttcatcttctctttctgttgccaaaaatggcagagtcctcatcgccggtgccaccggtttcatcgggaggtt
cgtagctgaagccagcctcgcagccggtcaacccacgtatgttctcgtccggcccggccctctgcacccttctaaggctg
acaccgtcaagtccttcaaagacaaaggcgcaataatcttacacgggctgatttccgataaaaccctaatggagaaaatg
ctaagagagcatgaaatcgagatagtaatatcagccgtgggtggtgccacaatattggaccagatcaccctagtcgacgc
cattgcggcagttggtacagttaagaggtttttgccgtcggagtttggacacgatgtggacagggctgatccggtggaac
cagggctcaccatgtatttggagaaacgcaaggttagacgttccgtcgagacatctggggtaccctacacatatatttgc
tgcaactcgattgcttcttggccctactttgacaacacccacccttctgaggttctcccaccgttggatcggttccaaat
ctacggtgatggcaccgtcaaagcctactttgtagacggtacggatatcgggaagttcacaatgaaaacggtggacgaca
tgcgaacaatcaacaaaaatgttcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatccctgtgggag
aagaaaattggccggaccctccctagagtcaccgtcactgaagatcacctactagcccttgctgcagataaccgtatacc
agaaagcattgtggcctcgttcacgcatgacatctttatcaaaggatgccaggttaattttgcagtggaagggcctcatg
atgtggaagtgggaactctctaccctggagattctttcaggaccttggatgagtgcttcgatggctttcttctcaagttg
aaggacaacctagagctagagctactgcaagaggaggaggatcagaaagtctccaccgaaaacaccgttgtcgaatccag
gactgtcactgccacttgtgcttga
back to top