LAR1, LAR1 (gene) Prunus avium

Gene Overview
Name LAR1
Gene Symbol LAR1
Type gene
Organism Prunus avium
Synonym leucoanthocyanidin reductase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LAR1GU938686.1-LAR1.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
leucoanthocyanidin reductaseLARPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database GU938686.1-LAR1.m1 N/A GU938686.1

Sequence(s):
>GU938686.1-LAR1.m11050
atgactgtgtcaacttgtgtttctgcagccaagaatggcagaatcctcattgttggtgctactggtttcatcgggaggtt
tgtggctgaagctagccttgatgctggccaacccacttatgttctggtccggccaggccctcttgacccttctaaggctg
acatcatcaaagccctcaaagacagaggcgctataatcttacaaggggtgatttctgataaggcactgatggagaaactg
ctaagagagcatgagattgaggtggtaatatcagccgtgggtggtgcaacaatattggaccagatcaccctggttgaggc
cattcaagctgttggcacaattaagaggtttttgccgtcagagtttgggcacgatgtggacagggctgatccggtggaac
cagggctcaccatgtatttggagaagcgtcaagtcaggcggtgggttgagaaatctggggtgccctacacttacatttgc
tgcaattccattgcttcttggccctacttcgacaacaagcatccttctgaggttcttccaccgttggatcagttccaaat
ctatggtgatggcagcgttaaagcctactttatagacggcactgatattggaaagttcacaataaaaacggtggaagaca
tccgaaccatcaacaaaaatgttcattttcgacccccttccaatttatacgacatcaatgggctggcatccctgtgggag
aagaaaattgtccgcacccttcccagagttaccatcactgaagatgacctactaaccattgctgcagagaaccgcatacc
ggaaagtatagtggcctcattcacgcacgatatctttatcaaaggttgccagatcaatttccctgtggagggccctcacg
atgtggagattgggactctttacccaggagaatctttcaggaccttggatgagtgcttcaatgactttcttctcaaattg
gaggacaagctagagctagagaaaaacaaagtttccaacaaaactaatgcagttgttgaaaccagggctgtcactgccac
gtgtgcttga
back to top