LAR2, LAR2 (gene) Malus x domestica

Gene Overview
Name LAR2
Gene Symbol LAR2
Type gene
Organism Malus x domestica
Synonym leucoanthocyanidin reductase 2
putative leucoanthocyanidin reductase
Description NA
Comment LAR2
MdLAR2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LAR2JX892955.1-LAR2.m1Malus x domesticamRNA
LAR2JX892952.1-LAR2.m1Malus x domesticamRNA
LAR2JX892949.1-LAR2.m1Malus x domesticamRNA
LAR2DQ139837.1-LAR2.m1Malus x domesticamRNA
LAR2AY830132.1-LAR2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
leucoanthocyanidin reductaseLARMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JX892955.1-LAR2.m1 Chr13:3255900..3259665
chr13:2860077..2863849
chr13:2860069..2863839
chr13:2848863..2852635
JX892955.1
predicted genes from whole genome assembly JX892952.1-LAR2.m1 Chr13:3255900..3259665
chr13:2860077..2863849
chr13:2860069..2863839
chr13:2848863..2852635
JX892952.1
predicted genes from whole genome assembly JX892949.1-LAR2.m1 Chr13:3255900..3259665
chr13:2860077..2863849
chr13:2860069..2863839
chr13:2848863..2852635
JX892949.1
predicted genes from whole genome assembly DQ139837.1-LAR2.m1 Chr13:3255900..3259665
chr13:2860077..2863849
chr13:2860069..2863839
chr13:2848863..2852635
DQ139837.1
predicted genes from whole genome assembly AY830132.1-LAR2.m1 Chr13:3255900..3259665
chr13:2860077..2863849
chr13:2860069..2863839
chr13:2848863..2852635
AY830132.1

Sequence(s):
>JX892955.1-LAR2.m11050
atgactgtttcaccttctctttctgttgccagaaatggcanagtcctcattgtcggtgccaccggtttcatcgggaggtt
tgtagctgaagccagcctcgccgccggccgacccacgtatgttctcgtccggcccggccctcttcatccttctaaggctg
acaccgtcaagtccttcaaacacaaaggcgccataatcttacacgggctgatttctgataaaaccctaatggagaagata
ctgagagagcatgaaatcgagacagtaatatcagccgtcggtggtgcgacaatattggaccanattgccttagtcgaggc
cattgcagcagttggtacagttaagaggtttttgccctccgagtttggacatgatgtggacagggctgatccggttgaac
cagggctcaccatgtacgaggagaaacgcaaggttagacgttgggtcgagaaatctggggtggcctacacatacatttgc
tgcaactccattgcctcttggccctactttgacaacacacacccttctgaggttctcccaccgttggatcggttccaaat
ctatggtgatggcaccgtcaaagcctattttgtagacggtacggatattggaaaattcacaataaagaccgtggacgaca
tccgaacaatcaacaaaaatgttcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatctctgtgggag
aagaaaattggccggactctccctagaatcaccatcactgaaaatcacttactagcccttgctgcagagaatcgtatacc
agaaagtatagtggcatcgttcacgcatgacatctttatcaaaggatgtcaggtgaattttgcagtggaggggcctcgtg
atgtggaagtgggaactctctaccccggagattctttcaggaccttggatgagtgcttcaatgactttcttctcaagttg
aaggacaacctagagccagtgcatgaggagaacgtctccaccaaaaacgccgtcgtcgaatccagggctgtcactcccac
ttgtgcttga
back to top
>JX892952.1-LAR2.m11050
atgactgtttcaccttctctttctgttgccagaaatggcanagtcctcattgtcggtgccaccggtttcatcgggaggtt
tgtagctgaagccagcctcgccgccggccgacccacgtatgttctcgtccggcccggccctcttcacccttctaaggctg
acaccgtcaagtccttcaaacacaaaggcgccataatcttacacgggctgatttctgataaaaccctagtggagaarata
ctgagagagcatgaaatcgagacagtaatatcagtcgtcggtggtgcgacaatattggaccagattgccttagtcgaggc
cattgcagcagttggtacagttaagaggtttttgccctccgagtttggacatgatgtggacagggctgatccggttgaac
cagggctcaccatgtacgaggagaaacgcaaggttagacgttgggtcgagaaatctggggtggcctacacatacatttgc
tgcaactccattgcctcttggccctactttgacaacacacacccttctgaggttctcccaccgttggatcggttccaaat
ctatggtgatggcaccgtcaaagcctattttgtagacggtacggatattggaaaattcacaataaagaccgtggacgaca
tccgaacaatcaacaaaaatgttcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatctctgtgggag
aagaaaattggccggactctccctagaatcaccatcactgaaaatcacttactagcccttgctgcagagaatcgtatacc
agaaagtatagtggcatcgttcacgcatgacatctttatcaaaggatgtcaggtgaattttgcagtggaggggcctcgtg
atgtggaagtgggaactctctaccccggagattctttcaggaccttggatgagtgcttcaatgactttcttctcaagttg
aaggacaacctagagccagtgcatgaggagaacgtctccaccaaaaacgccgtcgtcgaatccagggctgtcactcccac
ttgtgcttga
back to top
>JX892949.1-LAR2.m11050
atgactgtttcaccttctctttctgttgccaraaatggcanagtcctcattgtcggtgccaccggtttcatcgggaggtt
tgtagctgaagccagcctcgccgccggccgacccacgtatgttctcgtccggcccggccctcttcacccttctaaggctg
acaccgtcaagtccttcaaacacaaaggcgccataatcttacacgggctgatttctgataaaaccctagtggagaagata
ctgagagagcatgaaatcgagacagtaatatcagtcgtcggtggtgcgacaatattggaccanattgccttagtcgaggc
cattgcagcagttggtacagttaagaggtttttgccctccgagtttggacatgatgtggatagggctgatccggttgaac
cagggctcaccatgtacgaggagaaacgcaaggttagacgttgggtcgagaaatctggggtggcctacacatacatttgc
tgcaactccattgcctcttggccctactttgacaacacacacccttctgaggttctcccaccgttggatcggttccaaat
ctatggtgatggcaccgtcaaagcctattttgtagacggtacggatattggaaaattcacaataaagaccgtggacgaca
tccgaacaatcaacaaaaatgttcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatctctgtgggag
aagaaaattggccggactctccctagaatcaccatcactgaaaatcacttactagcccttgctgcagagaatcgtatacc
agaaagtatagtggcatcgttcacgcatgacatctttatcaaaggatgtcaggtgaattttgcagtggaggggcctcgtg
atgtggaagtgggaactctctaccccggagattctttcaggaccttggatgagtgcttcaatgactttcttctcaagttg
aaggacaacctagagccagtgcatgaggagaacgtctccaccaaaaacgccgtcgtcgaatccagggctgtcactcccac
ttgtgcttga
back to top
>DQ139837.1-LAR2.m11050
atgactgtttcaccttctctttctgttaccagaaatggcagagtcctcattgtcggtgccaccggtttcatcgggaggtt
tgtagctgaagccagcctcgccgccggccgacccacgtatgttctcgtccggcccggccctcttcacccttctaaggctg
acaccgtcaagtccttcaaacacaaaggcgccataatcttacacgggctgatttctgataaaaccctagtggagaagata
ctgagagagcatgaaatcgagacagtaatatcagtcgtcggtggtgcgacaatattggaccagattgccttagtcgaggc
cattgcagcagttggtacagttaagaggtttttgccctccgagtttggacatgatgtggatagggctgatccggttgaac
cagggctcaccatgtacgaggagaaacgcaaggttagacgttgggtcgagaaatctggggtggcctacacatacatttgc
tgcaactccattgcctcttggccctactttgacaacacacacccttctgaggttctcccaccgttggatcggttccaaat
ctatggtgatggcaccgtcaaagcctattttgtagacggtacggatattggaaaattcacaataaagaccgtggacgaca
tccgaacaatcaacaaaaatattcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatctctgtgggag
aagaaaattggccggactctccctagaatcaccatcactgaaaatcacttactagcccttgctgcagagaatcgtatacc
agaaagtatagtggcatcgttcacgcatgacatctttatcaaaggatgtcaggtgaattttgcagtggaggggcctcgtg
atgtggaagtgggaactctctaccccggagattctttcaggaccttggatgagtgcttcaatgactttcttctcaagttg
aaggacaacctagagccagtgcatgaggagaacgtctccaccaaaaacgccgtcgtcgaatccagggctgtcactcccac
ttgtgcttga
back to top
>AY830132.1-LAR2.m11050
atgactgtttcaccttctctttctgttgccagaaatggcagagtcctcattgtcggtgccaccggtttcatcgggaggtt
tgtagctgaagccagcctcgccgccggccgacccacgtatgttctcgtccggcccggccctcttcatccttctaaggctg
acaccgtcaagtccttcaaacacaaaggcgccataatcttacacgggctgatttctgataaaaccctaatggagaagata
ctgagagagcatgaaatcgagacagtaatatcagccgtcggtggtgcgacaatattggaccagattgccttagtcgaggc
cattgcagcagttggtacagttaagaggtttttgccctccgagtttggacatgatgtggacagggctgatccggttgaac
cagggctcaccatgtacgaggagaaacgcaaggttagacgttgggtcgagaaatctggggtggcctacacatacatttgc
tgcaactccattgcctcttggccctactttgacaacacacacccttctgaggttctcccaccgttggatcggttccaaat
ctatggtgatggcaccgtcaaagcctattttgtagacggtacggatattggaaaattcacaataaagaccgtggacgaca
tccgaacaatcaacaaaaatattcatttccgaccgccgagcaatttatacgacatcaatgggcttgcatctctgtgggag
aagaaaattggccggactctccctagaatcaccatcactgaaaatcacttactagcccttgctgcagagaatcgtatacc
agaaagtatagtggcatcgttcacgcatgacatctttatcaaaggatgtcaggtgaattttgcagtggaggggcctcgtg
atgtggaagtgggaactctctaccccggagattctttcaggaccttggatgagtgcttcaatgactttcttctcaagttg
aaggacaacctagagccagtgcatgaggagaacgtctccaccaaaaacgccgtcgtcgaatccagggctgtcactcccac
ttgtgcttga
back to top