LAR2, LAR2 (gene) Pyrus communis

Gene Overview
Name LAR2
Gene Symbol LAR2
Type gene
Organism Pyrus communis
Synonym leucoanthocyanidin reductase 2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
leucoanthocyanidin reductaseLARPyrus communisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LAR2DQ251191.1-LAR2.m1Pyrus communismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ251191.1-LAR2.m1 scaffold00716:105815..109395
DQ251191.1

Sequence(s):
>DQ251191.1-LAR2.m11059
atgactgtttcaccttctctttctgttgccataaatggcagagtcctcattgtcggtgccaccggtttcatcgggaggtt
tgtcgctgaagccagcctcgccgccggccaacccacgtatgttctcgtccggcctggccctcttcacccttctaaggctg
acaccgtcaagtccttcaaacacaaaggcgctataatcttacacgggctgatttctgataaaaccctaatggagaagata
ctgagagagcatgaaatcgagacagtaatatcagccgtcggcggtgcgacaatattggaccagattgccctagtcgaggc
catcgcagcagttggtacagttaagaggtttttgccttcggagtttggacatgatgtggacagggctgatccggttgaac
cagggctcaccatgtatgtggagaaacgcaaggttagacgttgggtcgagaaatctggggtgccctacacatacatttgc
tgcaactccattgcctcttggccctactttgacaacacacacccttctgaggttctcccaccgttggatcggttccaaat
ctacggtgatggcaccgtcaaagcctattttgtagacggtacggatattggaaaattcacaataaagaccgcgaaggaca
tccgaacaatcaacaaaaatgttcatttccgaccgccgagcaatttatacgacatcaacgggcttgcatctctgtgggag
aagaaaattggccggactctccctagaatcaccatcactgaaaatcacttactagcccttgctgcagagaatcgtatacc
agaaagtatagtggcatcgttcacgcacgacatctttatcaaaggatgtcaggtgaattttgcagtggaggggcctcgtg
atgtggaagtgggaactctctaccctggagattctttcaggaccttggatgagtgcttcaatgactttcttctcaaattg
aaggacaacctagagctagtgcaggaggagaaggatcagaaagtctccaccaaaaacgccgtcgtcgagtccagggctgt
cactcccacttgtgcttga
back to top