LAR, LAR (gene) Fragaria chiloensis

Gene Overview
Name LAR
Gene Symbol LAR
Type gene
Organism Fragaria chiloensis
Synonym leucoanthocyanidin reductase
Description NA
Comment LAR
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LARHM026187.1-LAR.m1Fragaria chiloensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
leucoanthocyanidin reductaseLARFragaria chiloensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM026187.1-LAR.m1 LG4:25704058..25705691
HM026187.1

Sequence(s):
>HM026187.1-LAR.m1625
gacaccatcaagtccctcaaagacaaaggcgccatcatcctacatggggtgatgagtgataagccattgatggagaagct
actgaaagagcatgagatcgagatagtcatatcagccgtgggtggtgcaacaattttagaccagatcaccctagtcgaag
ccattacttctgtaggaacggtcaagaggtttctgccgtcggagttcgggcacgacgtggaccgggccgacccggtggaa
ccgggtctgaccatgtatttggagaagcgcaaggtgaggcgtgcgattgagaagagtggggtcccttacacgtatatttg
ttgcaattctattgcttcttggccctactatgacaacaagcatccttccgaggttgtcccaccgttggatcagttccata
tctacggtgatggcacggttaaagcctacttcgtcgacggccctgatatcggaaaattcacaatgaagacggtggacgac
atcagaactatgaacaaaaatgttcactttcgaccctcaagcaatttatatgatatcaatggacttgcttcactgtggga
gaagaaaattggtcgcaccctcccaaaagttaccataactgagaacgacctattgactatggctg
back to top