LAR, LAR (gene) Fragaria x ananassa

Gene Overview
Name LAR
Gene Symbol LAR
Type gene
Organism Fragaria x ananassa
Synonym putative leucoanthocyanidin reductase
leucoanthocyanidin reductase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
leucoanthocyanidin reductaseLARFragaria x ananassagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LARDQ087253.1-LAR.m1Fragaria x ananassamRNA
LARDQ834906.2-LAR.m1Fragaria x ananassamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ087253.1-LAR.m1 LG4:25703896..25706072
DQ087253.1
mRNA parsed from NCBI nr database DQ834906.2-LAR.m1 LG4:25703896..25706053
DQ834906.2

Sequence(s):
>DQ087253.1-LAR.m11074
atgacggtgtcaccttctattgcctctgctgcaaagagtggccgagtcctcattatcggcgccaccggcttcatcggcaa
gttcgtcgccgaagccagcctcgactccggccttcccacttacgtcctcgtccgacccggcccgtctcgtccttccaagt
ccgacaccatcaagtccctcaaagacagaggcgccatcatcctacatggggtgatgagtgataagccattgatggagaag
ctactgaaagagcatgagatcgagatagtcatatcagccgtgggtggtgcaacaattctagaccagatcaccctagtcga
agccattacttctgtaggaacggtcaagaggtttctgccgtcggagttcgggcatgacgtggaccgggccgatccggtgg
aaccgggtctgaccatgtatttggagaagcgcaaggtgaggcgtgcgattgagaagagtggggtcccttacacgtatatt
tgttgcaattctattgcttcttggccctactatgacaacaagcatccttcggaggttatcccaccgttggatcagttcca
gatctacggtgatggcacggttaaagcctacttcgtcgacggccctgatatcggaaaattcacaatgaagacggtggacg
acatcagaactatgaacaaaaatgttcactttcgaccttcaagcaatttatatgatatcaatggacttgcttcactgtgg
gagaagaaaattggtcgcaccctcccaaaagttaccataactgagaacgacctattgactatggctgcagagaaccgtat
accagaaagtattgtagcctcgttcactcatgatatcttcatcaaaggttgtcaaaccaacttccccattgaaggtccga
atgatgttgatataggcactctctaccctgaagagtcttttaggactttggatgagtgcttcaatgattttcttgtcaaa
gttggggggaagctagagactgataaacttgccgccaagaacacggcagcggtcggagttgaacctatggcaatatcacg
gctacttgtgcctgaagaacattccatatcctaa
back to top
>DQ834906.2-LAR.m11053
atgacggtgtcaccttctattgcctctgctgcaaagagtggccgagtcctcataatcggcgccaccggcttcatcggcaa
gttcgtcgccgaagccagcctcgactccggccttcccacttacgtcctcgtccgacccggcccgtctcgtccttccaagt
ccgacaccatcaagtccctcaaagacagaggcgccatcatcctacatggggtgatgagtgataagccattgatggaaaag
ctactgaaagagcatgagatcgagatagtcatatcagccgtgggtggtgcaacaattttagaccagatcaccctagtcga
agccattacttctgtaggaacggtcaagaggtttctgccgtcggagttcgggcacgacgtggaccgggccgacccggtgg
aaccgggtctgaccatgtatttggagaagcgcaaggtgaggcgtgcgattgagaagagtggggtcccttacacgtatatt
tgttgcaattctattgcttcttggccctactatgacaacaagcatccttccgaggttgtcccaccgttggatcagttcca
aatctacggtgatggcactgttaaagcttacttcgtcgacggccctgatatcggaaaattcacaatgaagacggtggacg
acatcagaactatgaacaaaaatgttcactttcgaccttcaagcaatttatatgatatcaatggacttgcttcactgtgg
gagaagaaaattggtcgcaccctcccaaaagttaccataactgagaacgacctattgactatggctgcagagaaccgtat
accagaaagtattgtagcctcgttcactcatgatatcttcatcaaaggttgtcaaaccaacttccccattgaaggcccga
atgatgttgatataggcactctctaccctgaagagtcttttaggactttggatgagtgcttcaatgattttcttgtcaaa
gttggggggaagctagagactgataaacttgccgccaagaacaaggcagcggtcggagttgaacctatggcaatcacggc
tacttgtgcctga
back to top