LFY-2, LFY-2 (gene) Cydonia oblonga

Gene Overview
Name LFY-2
Gene Symbol LFY-2
Type gene
Organism Cydonia oblonga
Synonym LEAFY protein
CoLFY-2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY-2AB162037.1-LFY-2.m1Cydonia oblongamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCydonia oblongagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB162037.1-LFY-2.m1 N/A AB162037.1

Sequence(s):
>AB162037.1-LFY-2.m11215
atggatccagatgccttctctgcgaacttgttcaagtggggcctacgaggcatggttgtgccgacgaaccgggttcagct
ggaagcagccgtgccaccagcagcggctggctgcactttgcggccgccaggtgagcttggacttggagggcttgaggact
tgttccaggcatatggggtcagatactatacggcggcaaagatagcggagcttggatttactgtgaagaccctcttggac
atgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttgcttgttggggagaggta
tggtatcaaagctgccgtcagagccgagcgtcgccgccttgatgaggaggaatctcggcgccgcaaccctgtctctggtg
ataccactaccaatgcccttgatgctctctcccaagaagggctgtcggaagagccggtgcaacaagagaaggagatggtg
gggagcggaggaggggcggcgtgggaggttgcgactgcaggggagaggcggaagaagcagcggaggatgaagaaggggca
atttaaaatttgtagtgctggagggcgtcataataatgataataacgagggtgtggacgacgaggacgacaacgacatgg
acgacatgactgggcatgggaacggtggaggagggggaatgctgggagagagacagagggagcaccctttcattgtgacg
gagccaggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgcgatttctt
gatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgtttaggtatgcca
aaaaggcaggggcaagctacatcaacaagccaaagatgcggcactacgtgcactgttacgccctgcattgcttggatgag
gaggcatcgaatgcgctgaggagagcgttcaaggagagaggcgaaaatgtcggggcttggcggcaggcatgttacaagcc
tcttgtggccattgcagcaggccaaggctgggacattgatgccatcttcaattcccatccccgtctctctatttggtatg
ttcccacgaagcttcgtcagctttgtcacgccgagcgcaacaacgccactgcctctagctctgcctccggcggcggcgat
cacctgccctattga
back to top