LFY-2, LFY-2 (gene) Fragaria x ananassa

Gene Overview
Name LFY-2
Gene Symbol LFY-2
Type gene
Organism Fragaria x ananassa
Synonym LEAFY like protein 2
Description NA
Comment FaLFY-2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY-2JN788260.1-LFY-2.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JN788260.1-LFY-2.m1 LG5:5849185..5851313
JN788260.1

Sequence(s):
>JN788260.1-LFY-2.m11239
atggatccaaacgcgttcactgcgagtttgttcaagtgggacctccgtggcatggctgttccgccgaaccggcttccgct
cgaggcggcggccgcggccgcagttgctccccaacaagtcgccgcggctgccgcagccgctggttactcggtgcgggcgc
cgagggagactggggggctggaggagatgttccgggcttatggagtgaggtactacacggcggcaaggatagcggagctc
gggttcactgtgagcacgcttttggacatgagggatgaggagcttgacgacatgatgaacagcgtgtgtcagtttttccg
ggtggagctactcgtcggggagaggtacggcatcaagtctgccatccgagctgagaggagacgactcgaggaggaggact
cgcggcggcgccacgctctctccggtgacaccaacgctatgagtgctctctcacaagaagggctgtcggaggagccggtg
caacaagagagggagatggtggggagtggcggagcagcagcatgggaagggggtacggcggcggagaggcggaagaagct
gaggaggattaggagaggtggtggtcataggagtaataacgagggtattgatgatgatgaggatgaagagaacgatgacg
gactcaatggaggaggaggggagcgcccgggtagggcattaggtgtgaggggtggtgggagagagagacagagggagcac
cccttcgtcgtgacggaggctggggaggtggcacgtggcaaaaagaacggactggattacctcttccatctctacgagca
gtgccatcagtttttgacccaggtgcagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtcacaaaccagg
tgtttagacatgcgaaagaggaaggagcgaactacatcaacaagccgaaaatgcggcactacgttcactgctacgcgctg
cattgtctggacgaggagcgttcaattgcgctgaggcgtgagtgcaagctgcgaggagagaacatcggggcgtggaggca
ggcatgctacaggcctgttgtggaaatagctgcaggccaaggttgggacattgacgccattttcagtgcacatcctcgac
tatctgtttggtacgttcctaccaaacttcgtcagctttgtcacgccgaacgcaacaatgccgctgcctctagctccgcc
tcaggtggaagcggtactactgatccgcttccctactga
back to top