LFY-2, LFY-2 (gene) Pseudocydonia sinensis

Gene Overview
Name LFY-2
Gene Symbol LFY-2
Type gene
Organism Pseudocydonia sinensis
Synonym LEAFY protein
CsLFY-2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY-2AB162038.1-LFY-2.m1Pseudocydonia sinensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPseudocydonia sinensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB162038.1-LFY-2.m1 N/A AB162038.1

Sequence(s):
>AB162038.1-LFY-2.m11218
atggatccagatgccttctctgcgaacttgttcaagtggggcctacgaggcatggttgtgccgacgaaccgggttcagct
ggaagcagccgtgccaccaggagcggcggctggctgtactttgcggccgccaggtgagcttggacttggagggcttgagg
acttgttccaggcatatggggtcagatactatacggcggcaaagatagcggagcttggatttactgtgaagaccctcttg
gacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttgcttgttggggagag
gtatggtatcaaagctgccgtcagagccgagcgtcgccgccttgatgaggaggaatctcggcggcgcaaccctgtctctg
gtgataccactaccaatgcccttgatgctctctcccaagaagggttgtcggaggagccggtgcaacaagagaaggagatg
gtggggagcggaggaggggcggcgtgggaggttgggacggcaggggagaggcggaagaagcagcggaggatgaagaaggg
gcaatttaaaaattgtagtgctggagggcgtcagaataatgataataacgagggtgtggacgacgaggacgacaatgaca
tggacgacatgactgggcatggaaacggtggaggagggggaatgctgggagagagacagagggagcacccgttcattgtg
acggagccaggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgcgattt
cctgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacgaaccaagtgtttaggtatg
ccaaaaaggcaggggcaagctacatcaacaagccaaagatgcggcactacgtgcactgctacgccctgcattgcttggat
gaggaggcatcaaatgcgctgaggagagcgttcaaggagagaggcgaaaatgtcggggcttggcggcaggcatgttacaa
gcctcttgtggccattgcagcaggccaaggatgggacattgatgccatcttcaattcccatccccgtctctctatttggt
atgttcccacgaagctacgtcagctttgtcacgccgagcgcaacaacgccactgcctctagcactgcctccggcagcggt
gatcacctgccctattga
back to top