LFY-3, LFY-3 (gene) Fragaria x ananassa

Gene Overview
Name LFY-3
Gene Symbol LFY-3
Type gene
Organism Fragaria x ananassa
Synonym LEAFY like protein 3
Description NA
Comment FaLFY-3
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY-3JN788261.1-LFY-3Fragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY-3JN788261.1-LFY-3.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JN788261.1-LFY-3 N/A JN788261.1
mRNA parsed from NCBI nr database JN788261.1-LFY-3.m1 N/A JN788261.1

Sequence(s):
>JN788261.1-LFY-32250
atggatccaaacgcgttcactgcgagtttgttcaagtgggacctccgtggcatgacggttccgcctaaccggcttccgct
cgaggcggcggccacagttgctccccaacaagccgcgggttattcggtgcgggcgccgagggagattggggggctggagg
agatgttccgggcttatggagtgaggtactacacggcggcaagaatagcggagctcgggttcactgtgagcacgcttttg
gacatgagggatgaggagcttgacgacatgatgaacagcgtgtgtcagtttttccgggtggagctactcgtcggggagag
gtacggcatcaagtctgccatccgagctgagaagagacgacttgaggaggaggaggactcgcggcggcgccacgctctct
ccggtgacaccgacgctatggatgctccctcacaagaaggttaatttcctagcaaacacatgagtactcatatatgtatc
gatctgacttcttacctttttcttttgctttgtttggtaattagtgagaatttaacaggctagacctaatctttgcacat
aagtatttcccttattagcgtctaatgattacagaatattgttaggtttgttaatagttcaaaaactttacactgtgcct
cagatgtttaagagcatatgtgttttgatttaatcttgttctcttcaaaagaaatttactaagaagtatgaagattcagg
agtgattcgctatactcatattatttttaatgatcactgatcgtggttaaatctttattcacatgtgtttactgggaaat
aaaagaagtatatctacatgtctatttgagtatatgtgtgttcgatacattaatatgatattgatgcatgtgatgggatg
gctggacagggctgtcggaggagccggtgcaacaagagagggagatggtggggagtggcggaggagcagcatgggaaggg
ggtacggcggcggagaggcggaagaagctgaggaggattgggagaggtgatgggcataggagtagcaacgagggtattga
tgatgacgaggatgaagagaacgatgacgggatcaatggaggaggaggggagcgcccgggtagggcattaggtatgaggg
gtaccggtggtgggagagagagacagagggagcaccccttcgtcgtgacggaggctggggaggtggcacgtggcaaaaag
aacggactggattacctcttccatctctacgagcagtgccatcagtttttgacccaggtgcggaacattgccaaggagcg
cggtgaaaaatgtcccaccaaggtacgtaatggttaaaaccctacacatgcattaattctcctgctatgctactgtgggt
aaaacagtagttaatcattgtaatgagtagtaacaaggaggtaaactactattcgctcaaaagggaattgctcataacgg
tagtaattgtgatttgacaaatttacccgatatgagttatttcaatcaatcaatagtagctgaagcagacccatcccagt
tcgtaccaattaaccagctgttcctcatgacaccacagtaattggccagttttcaacctttgattattgattgatcccct
gatgtaatatgaactttaaacacgaagctgtaattaacaagtaatcataaatatgacattgattttacccctcaattgat
tagaggatgtgatcggtatagatgttcatacgcagcagtaatgtattgatttgaagactgaaaaaaggcaaatgaacaat
tataatgcgttcctaaatttgctacttgaaagttgaaacacatatatcaagctagctctggttcatagtctataccataa
ttgaattaatttcttgcactataaatcttgatctacaggtcacaaaccaggtgtttagatatgcgaaagaggaaggagcg
aactacatcaacaagccgaaaatgcggcactacgttcactgctacgcgctgcattgtctggacgaggagcgttcaattga
gctgaggcgtgagtgcaagctgcgaggagagaacatcggggcatggaggcaggcgtgctacaggcctgttgtggaaatag
ctgcaggccaaggttgggacattgacgccattttcagtgcacatcctcgactatctgtttggtatgttcctaccaaactt
cgtcagctttgtcacgccgagcgcaaccatgctgctgcctctagctccgcctcaggtggaagcggtactactgatccgct
tccctactga
back to top
>JN788261.1-LFY-3.m11224
atggatccaaacgcgttcactgcgagtttgttcaagtgggacctccgtggcatgacggttccgcctaaccggcttccgct
cgaggcggcggccacagttgctccccaacaagccgcgggttattcggtgcgggcgccgagggagattggggggctggagg
agatgttccgggcttatggagtgaggtactacacggcggcaagaatagcggagctcgggttcactgtgagcacgcttttg
gacatgagggatgaggagcttgacgacatgatgaacagcgtgtgtcagtttttccgggtggagctactcgtcggggagag
gtacggcatcaagtctgccatccgagctgagaagagacgacttgaggaggaggaggactcgcggcggcgccacgctctct
ccggtgacaccgacgctatggatgctccctcacaagaagggctgtcggaggagccggtgcaacaagagagggagatggtg
gggagtggcggaggagcagcatgggaagggggtacggcggcggagaggcggaagaagctgaggaggattgggagaggtga
tgggcataggagtagcaacgagggtattgatgatgacgaggatgaagagaacgatgacgggatcaatggaggaggagggg
agcgcccgggtagggcattaggtatgaggggtaccggtggtgggagagagagacagagggagcaccccttcgtcgtgacg
gaggctggggaggtggcacgtggcaaaaagaacggactggattacctcttccatctctacgagcagtgccatcagttttt
gacccaggtgcggaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtcacaaaccaggtgtttagatatgcga
aagaggaaggagcgaactacatcaacaagccgaaaatgcggcactacgttcactgctacgcgctgcattgtctggacgag
gagcgttcaattgagctgaggcgtgagtgcaagctgcgaggagagaacatcggggcatggaggcaggcgtgctacaggcc
tgttgtggaaatagctgcaggccaaggttgggacattgacgccattttcagtgcacatcctcgactatctgtttggtatg
ttcctaccaaacttcgtcagctttgtcacgccgagcgcaaccatgctgctgcctctagctccgcctcaggtggaagcggt
actactgatccgcttccctactga
back to top