LFY1, LFY1 (gene) Malus x domestica

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Malus x domestica
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991426.1-LFY1Malus x domesticagene
LFY1GU991423.1-LFY1Malus x domesticagene
LFY1GU991465.1-LFY1Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991426.1-LFY1.m1Malus x domesticamRNA
LFY1GU991423.1-LFY1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly GU991426.1-LFY1 Chr06:27319210..27320358
chr11:20415788..20416937
chr11:23582432..23583581
GU991426.1
predicted genes from whole genome assembly GU991423.1-LFY1 Chr06:27319210..27320358
chr11:20415788..20416937
chr11:23582432..23583581
GU991423.1
gene parsed from NCBI nr database GU991465.1-LFY1 N/A GU991465.1
predicted genes from whole genome assembly GU991426.1-LFY1.m1 Chr06:27319210..27319617
chr11:20415788..20416197
chr11:23583172..23583581
GU991426.1
predicted genes from whole genome assembly GU991423.1-LFY1.m1 Chr06:27319210..27319617
chr11:20415788..20416197
chr11:23583172..23583581
GU991423.1

Sequence(s):
>GU991426.1-LFY11055
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
cagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcatgataatgatca
tgacgagggtgtagacgacaaggacgacgacatggacaacatgaatgggcaggggaacggtggaggaggggggttgctag
gcgagagacagagggagcacccgttcattgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattac
ctcttctatctctacgagctgtgccgtgatttcttgatccaggtccagaacattgccaaggggcgcggtgaaaaatgtcc
aaccaaggttggacgttcatcaataaagaaaaagactcttatactcatgtataaaattaccacaaagacttggtgattgt
ctaagaaaaacagttatggggttttttttcactgtattcaccgcattgatgcaccttgttggtatgcactggaaacttag
gtagttgaccctaagcgttatttacacactcatttctacctttcacacattattctcaattcatggtcgttggatcgaat
aaattaaaaaagatcaattgaccaaaattaataagaatgtgtcagaggtaaatagatgtgtgtgataaaagcactactaa
aagcacttctttccagttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtatttt
cgattacatcgaatttgatacatgcggtctgcaaattttgtcaatttaagaatatccgtcaacttttgtgaatttcttgt
acgaaatctgttaaattcatcatcgtacaagaaattcacattgttgatgaatattctttgaattggaactactttcttac
atcatgagtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaa
ctatttagttcggct
back to top
>GU991423.1-LFY11055
tgtcggaggagccagtgcaacaagagaaggagatggtggggaccggagtagggatggcgtgggaggttgtgacggcgggg
cagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcatgataatgatca
aaacgagggtgtagacgacaaggacgacgacatggacaacatgaatgggcaggggaacggtggaggaggggggttgctag
gcgagagacagagggagcacccgttcattgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattac
ctcttctatctctacgagctgtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcc
aaccaaggttggacgttcatcaataaagaaaaagactcttatactcatgtataaaattaccacaaagacttggtgattgt
ctaagaaaaacagttatggggttttttttcactgtattcaccgcattgatgcaccttgttggtatgcactggaaacttag
gtagttgaccctaagcgttatttacacactcatttttacctttcacacattattctcaattcatggtcgttggatcgaat
aaattaaaaaagatcaattgaccaaaattaataagaatgtgtcagaggtaaatagatgtgtgtgataaaagcactactaa
aagcacttctttccagttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtatttt
cgattacatcgaatttgatacatgcggtctgcaaattttgtcaatttaagaatatccgtcaacttttgtgaatttcttgt
acgaaatctgttaaattcatcatcgtacaagaaattcacattgttgatgaatattctttgaattggaactactttcttac
atcatgagtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaa
ctatttagttcggct
back to top
>GU991465.1-LFY1642
tggacgttcatcaataaagaaaaagactcttatactcatgtataaaattaccacaaagacttggtgattgtctaagaaaa
acagttatggggttttttttcactgtattcaccgcattgatgcaccttgttggtatgcactggaaacttaggtagttgac
cgtaaacgttatctatacactcatttttacctttcacacatcattctcaatttatggtcgttggatcgaataaattgaaa
aagatcaattgaccaaaattaataagaatgtgtcaaagataaatagatgtgtgtgaaaagcactactaaaagcacttctt
tccagtatgaacaacacattttcaatcaatttagatttggcaaagtttcacttttgtttatgtattttcgattacatcga
atttaatacaagcggtctgcaaattttgtcaatttaagaatatccgtctacttccgtgaatttcttgcatgaaatctatt
aaatttatcctcatacaagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaataaatttgattcgactatttaggtcga
ct
back to top
>GU991426.1-LFY1.m1407
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
cagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcatgataatgatca
tgacgagggtgtagacgacaaggacgacgacatggacaacatgaatgggcaggggaacggtggaggaggggggttgctag
gcgagagacagagggagcacccgttcattgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattac
ctcttctatctctacgagctgtgccgtgatttcttgatccaggtccagaacattgccaaggggcgcggtgaaaaatgtcc
aaccaag
back to top
>GU991423.1-LFY1.m1407
tgtcggaggagccagtgcaacaagagaaggagatggtggggaccggagtagggatggcgtgggaggttgtgacggcgggg
cagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcatgataatgatca
aaacgagggtgtagacgacaaggacgacgacatggacaacatgaatgggcaggggaacggtggaggaggggggttgctag
gcgagagacagagggagcacccgttcattgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattac
ctcttctatctctacgagctgtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcc
aaccaag
back to top