LFY1, LFY1 (gene) Malus niedzwetzkyana

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Malus niedzwetzkyana
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991424.1-LFY1Malus niedzwetzkyanagene
LFY1GU991463.1-LFY1Malus niedzwetzkyanagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991424.1-LFY1.m1Malus niedzwetzkyanamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYMalus niedzwetzkyanagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly GU991424.1-LFY1 Chr06:27319210..27320358
chr11:20415788..20416937
chr11:23582432..23583581
GU991424.1
predicted genes from whole genome assembly GU991463.1-LFY1 Chr06:27319714..27320358
chr11:20416294..20416937
chr11:23582432..23583075
GU991463.1
predicted genes from whole genome assembly GU991424.1-LFY1.m1 Chr06:27319210..27319617
chr11:20415788..20416197
chr11:23583172..23583581
GU991424.1

Sequence(s):
>GU991424.1-LFY11053
tgtcggaggagccagtgcaacaagagaaggagatggtggggaccggagtagggatggcgtgggaggttgtgacggcgggg
cagaggcggaagaagcagcggaggatgaagaaggggcaatataagatctttattgctggagggggtcatgataatgatca
taacgagggtgtagacgacaaggacgacgacatggacaacatgaatgggcaggggaacggtggaggaggggggttgctag
gcgagagacagagggagcacccgttcattgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattac
ctcttctatctctacgagctgtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcc
aaccaaggttggacgttcatcaataaagaaaaagactcttatactcatgtataaaattaccacaaagacttggtgattgt
ctaagaaaaacagttatggggttttttttcactgtattcaccgcattgatgcaccttgttggtatgcactggaaacttag
gtagttgaccctaagcgttatttacacactcatttttacctttcacacattattctcaattcatggtcgttggatcgaat
aaattaaaaaagatcaattgaccaaaattaataagaatgtgtcagaggtaaatagatgtgtgtgaaaagcactactaaaa
gcacttctttccagttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcg
attacatcgaatttgatacatgcggtctgcaaattttgtcaatttaagaatatccgtcaacttttgtgaatttcttgtac
gaaatctgttaaattcatcatcgtacaagaaattcacattgttgatgaatattctttgaattggaactactttcttacat
catgagtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaact
atttagttcggct
back to top
>GU991463.1-LFY1644
tggacgttcatcaataaagaaaaagactcttatactcatgtataaaattaccacaaagacttggtgattgtctaagaaaa
acagttatggggttttttttcactgtattcaccgcattgatgcaccttgttggtatgcactggaaacttaggtagttgac
cctaagcgttgtttacacactcatttttacctttcacacattattctcaattcatggtcgttggatcgaataaattaaaa
aagatcaattgaccaaaattaataagaatgtgtcagaggtaaatagatgtgtgtgaaaagcactactaaaagcacttctt
tccagttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattctcgattacatcg
aatttgatacatgcggtctgcaaattttgtcaatttaagaatatccgtcaacttttgtgaatttcttgtacgaaatctgt
taaattcatcatcgtacaagaaattcacattgttgatgaatattctttgaattggaactactttcttacatcatgagtca
aatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactacttagttc
ggct
back to top
>GU991424.1-LFY1.m1407
tgtcggaggagccagtgcaacaagagaaggagatggtggggaccggagtagggatggcgtgggaggttgtgacggcgggg
cagaggcggaagaagcagcggaggatgaagaaggggcaatataagatctttattgctggagggggtcatgataatgatca
taacgagggtgtagacgacaaggacgacgacatggacaacatgaatgggcaggggaacggtggaggaggggggttgctag
gcgagagacagagggagcacccgttcattgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattac
ctcttctatctctacgagctgtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcc
aaccaag
back to top