LFY1, LFY1 (gene) Malus sieboldii

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Malus sieboldii
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991425.1-LFY1Malus sieboldiigene
LFY1GU991464.1-LFY1Malus sieboldiigene
LFY1GU991461.1-LFY1Malus sieboldiigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991425.1-LFY1.m1Malus sieboldiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYMalus sieboldiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly GU991425.1-LFY1 Chr06:27319210..27320358
chr11:20415788..20416937
chr11:23582432..23583581
GU991425.1
predicted genes from whole genome assembly GU991464.1-LFY1 Chr06:27319714..27320358
chr11:20416294..20416937
chr11:23582432..23583075
GU991464.1
predicted genes from whole genome assembly GU991461.1-LFY1 Chr06:27319714..27320358
chr11:20416294..20416937
chr11:23582432..23583075
GU991461.1
predicted genes from whole genome assembly GU991425.1-LFY1.m1 Chr06:27319210..27319617
chr11:20415788..20416197
chr11:23583172..23583581
GU991425.1

Sequence(s):
>GU991425.1-LFY11054
tgtcggaggagccagtgcaacaagagaaggagatggtggggaccggagtagggatggcgtgggaggttgtgacggcgggg
cagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcatgataatgatca
taacgagggtgtagacgacaaggacgacgacatggacaacatgaatgggcaggggaacggtggaggaggggggttgctag
gcgagagacagagggagcacccgttcattgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattac
ctcttctatctctacgagctgtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcc
aaccaaggttggacgttcatcaataaagaaaaagactcttatactcatgtataaaattaccacaaagacttggtgattgt
ctaagaaaaacagttatggggtttttttcactgtattcaccgcattgatgcaccttgttggtatgcactggaaacttagg
tagttgaccctaagcgttatttacacactcatttttacctttcacacattattctcaattcatggtcgttggatcgaata
aattaaaaaagatcaattgaccaaaattaataagaatgtgtcagaggtaaatagatgtgtgtgataaaagcactactaaa
agcacttctttccagttatgaacaacacattttcaatcaatttagatttggcaaagtttcacttttgtttatgtattttc
gattacatcgaatttgatacatgcggtctgcaaattttgtcaatttaagaatatccgtcaacttttgtgaatttcttgta
cgaaatctgttaaattcatcatcgtacaagaaattcacattgttgatgaatattctttgaattggaactactttcttaca
tcatgagtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaac
tatttagttcggct
back to top
>GU991464.1-LFY1643
tggacgttcatcaataaagaaaaagactcttatactcatgtataaaattaccacaaagacttggtgattgtctaagaaaa
acagttatggggtttttttcactgtattcaccgcattgatgcaccttgttggtatgcactggaaacttaggtagttgacc
ctaagcgttatttacacactcatttttacctttcacacattattctcaattcatggtcgttggatcgaataaattaaaaa
agatcaattgaccaaaattaataagaatgtgtcagaggtaaatagatgtgtgtgaaaagcactactaaaagcacttcttt
ccagttatgaacaacacattttcaatcaatttagatttggcaaagtttcacttttgtttatgtattttcgattacatcga
atttgatacatgcggtctgcaaattttgtcaatttaagaatatccgtcaacttttgtgaatttcttgtacgaaatctgtt
aaattcatcatcgtacaagaaattcacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
gct
back to top
>GU991461.1-LFY1643
tggacgttcatcaataaagaaaaagactcttatactcctgtataaaattaccacaaagacttggtgattgtctaagaaaa
acagttatggggtttttttcactgtattcaccgcattgatgcaccttgttggtatgcactggaaacttaggtagttgacc
ctaagcgttatttacatactcatttttacctttcacatattattctcaattcgtggtcgttggatcgaataaattaaaga
agatcaattgaccaaaattaataagaatgtgtcagagataaatagatgtgtgtgaaaagcactactaaaagcacttcttt
ccaattatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcgattacatcga
atttgataaatgcggtctgcaaattttgtcaatttaagaatatccgtcaacttttgtaaatttcttgtacgaaatctgtt
aaattcatcatcgtacaagaaattcacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcga
atttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
gct
back to top
>GU991425.1-LFY1.m1407
tgtcggaggagccagtgcaacaagagaaggagatggtggggaccggagtagggatggcgtgggaggttgtgacggcgggg
cagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcatgataatgatca
taacgagggtgtagacgacaaggacgacgacatggacaacatgaatgggcaggggaacggtggaggaggggggttgctag
gcgagagacagagggagcacccgttcattgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattac
ctcttctatctctacgagctgtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcc
aaccaag
back to top