LFY1, LFY1 (gene) Pyrus amygdaliformis

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus amygdaliformis
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991429.1-LFY1Pyrus amygdaliformisgene
LFY1GU991427.1-LFY1Pyrus amygdaliformisgene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus amygdaliformisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991429.1-LFY1 scaffold00563:8422..9067
GU991429.1
gene parsed from NCBI nr database GU991427.1-LFY1 N/A GU991427.1

Sequence(s):
>GU991429.1-LFY1645
tggacgttcatcaataaagaaaaagactcttatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcactttgttgttatggtatgcactagaaacttaggtagt
tgaaccctaagtgttatctacacactcatttttacctctcacacatcattctcaattcatggttcggatcgaatgaattg
aaaatgatcaattgtccaaaattaataagaatgtgttagagataaaaagatgtgtgtgaaaagcactactaaaagcattt
ctttccggttatgaaccacacattttaatcaatttagatttggcaaagtttcacttttgtttatgtattttcaattacat
cgaatttaatacatgcggtccgcaaatttaatcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatct
gttaaatttatcctcgtacaagaaatttacattgttgatgaatattctttgaattggaactactttcttatatcatgagt
caaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaattaatttgattcaactattgaggc
cgact
back to top
>GU991427.1-LFY1646
tggacgttcatcaataaagaaaaagactcttatactcatataaaattaccaaaaagacttggtgattgtctaagaaaaac
aattatggggtttttttcattgtattcacctcattgatgcactttgttgttatggtatgcactagaaacttaggtagttg
aaccctaagtattatctacacactcatttttacctctcacacatcattctcaattcatggccttcggatcaaatgaattg
aaaatgatcaattgaccaaaattaataagagtgtgttagagataaaaagatgtgtgtgaaaagcacgactaaaaacattt
ctttccggttatggaccacacattttcaatcaatttagatttggcaaagtttcacttttgtttatgtattttcaattaca
tcgaatttaatacatgcggtctgcaaatttaatcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatc
tgttaaatttatcctcgtacaagaaatttacattgttgatgaatattctttgaattggaactactttcttatatcatgag
tcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaattaatttgattcaactatttagg
tcgact
back to top