LFY1, LFY1 (gene) Pyrus calleryana

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus calleryana
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991414.1-LFY1Pyrus calleryanagene
LFY1GU991412.1-LFY1Pyrus calleryanagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991414.1-LFY1.m1Pyrus calleryanamRNA
LFY1GU991412.1-LFY1.m1Pyrus calleryanamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus calleryanagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991414.1-LFY1 N/A GU991414.1
gene parsed from NCBI nr database GU991412.1-LFY1 N/A GU991412.1
mRNA parsed from NCBI nr database GU991414.1-LFY1.m1 scaffold00563:9164..9571
GU991414.1
mRNA parsed from NCBI nr database GU991412.1-LFY1.m1 scaffold00563:9164..9571
GU991412.1

Sequence(s):
>GU991414.1-LFY11045
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggaggcggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
tcgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaaca
attatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagttga
accctaagcgttatctacacacttatttttacctctcacacgtcattctcaattcatagccgtcatatcgaatgaattga
gaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacactactaaaagcacttc
tttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactctcgtttatgtattttcaattacgt
cgaatttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaattt
gttaaatttatccttgtaaagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtc
aaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactatttagtt
cgact
back to top
>GU991412.1-LFY11042
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaata
attatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacccta
agcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaaaga
tcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaatgctactaaaagcacttctttc
cggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa
tttaatacaagcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatttgtta
aatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaaa
tttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactatttagttcga
ct
back to top
>GU991414.1-LFY1.m1395
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggaggcggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>GU991412.1-LFY1.m1395
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top