LFY1, LFY1 (gene) Pyrus communis

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus communis
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991420.1-LFY1Pyrus communisgene
LFY1GU991431.1-LFY1Pyrus communisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991420.1-LFY1.m1Pyrus communismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus communisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991420.1-LFY1 N/A GU991420.1
gene parsed from NCBI nr database GU991431.1-LFY1 N/A GU991431.1
mRNA parsed from NCBI nr database GU991420.1-LFY1.m1 scaffold00563:9164..9571
GU991420.1

Sequence(s):
>GU991420.1-LFY11048
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggaggaagaaggggcaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagaccattacactcatatataaaattaccacaaagacttggtgattgtctaagaaaaaca
attatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagttgg
accctaagcgttatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatatcgattgaattga
aaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacactactaaaagcacc
tctttccggttatgaacaacacattttcaatcaatttagatttggcaaagttccactttcgtttatgtattttcaattac
gtcgaatttaatacatgcggtctgaaaattttgtcaatttaagaatatctgtcaacttccgtgaatttcttgtatgaaat
ctgttaaatttatcctcgtataagaaatttacattgttgatggatattctttgaattggaactactttcttacatcatga
gtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtaagtttgtagtccaaaagtaatttgattcaactattta
gttcgact
back to top
>GU991431.1-LFY1649
tggacgttcatcaataaagaaaaagaccattacactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tggaccctaagcgttatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatatcgaatgaat
tgaaaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacactactaaaggcac
ctctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgtcaaatttaatacatgcggtctgaaaattttgtcaatttaagaatatctgtcaacttccgtgaatttcttgtatgaaa
tctgttaaatttatcctcgtataagaaatttactttgttgatgaatattctttgaattggaactactttcttacatcatg
agtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top
>GU991420.1-LFY1.m1395
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggaggaagaaggggcaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top