LFY1, LFY1 (gene) Pyrus dimorphophylla

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus dimorphophylla
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991413.1-LFY1Pyrus dimorphophyllagene
LFY1GU991403.1-LFY1Pyrus dimorphophyllagene
LFY1GU991456.1-LFY1Pyrus dimorphophyllagene
LFY1GU991443.1-LFY1Pyrus dimorphophyllagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991413.1-LFY1.m1Pyrus dimorphophyllamRNA
LFY1GU991403.1-LFY1.m1Pyrus dimorphophyllamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus dimorphophyllagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991413.1-LFY1 N/A GU991413.1
gene parsed from NCBI nr database GU991403.1-LFY1 N/A GU991403.1
gene parsed from NCBI nr database GU991456.1-LFY1 N/A GU991456.1
gene parsed from NCBI nr database GU991443.1-LFY1 N/A GU991443.1
mRNA parsed from NCBI nr database GU991413.1-LFY1.m1 scaffold00563:9164..9571
GU991413.1
mRNA parsed from NCBI nr database GU991403.1-LFY1.m1 scaffold00563:9164..9571
GU991403.1

Sequence(s):
>GU991413.1-LFY11048
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggaaggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggaggcggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaaca
attatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagttga
accctaagcgttatctacacacttatttttacctctcacacgtcattctcaattcatagccgtcatatcgaatgaattga
aaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacactactaaaagcact
tctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattac
gtcgaatttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaat
ttgttaaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatga
gtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattta
gttcgact
back to top
>GU991403.1-LFY11042
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaata
attatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacccta
agcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaaaga
tcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacgctactaaaagcacttctttc
cggttatgaacagcacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa
tttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtta
aatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaaa
tttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcga
ct
back to top
>GU991456.1-LFY1649
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tgaaccctaagcgttatctacacacttatttttacctctcacacgtcattctcaattcatagccgtcatatcgaatgaat
tgaaaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacactactaaaagcac
ttctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgtcgaatttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaa
tttgttaaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatg
agtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top
>GU991443.1-LFY1643
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctgagaaaa
ataattatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacc
ctaagcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaa
agatcaattgaccaaaattaataaggatgtgtcagagataaaaagatgtgtgtgaaaaacgctactaaaagcacttcttt
ccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcga
atttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtt
aaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
act
back to top
>GU991413.1-LFY1.m1395
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggaaggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggaggcggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>GU991403.1-LFY1.m1395
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top