LFY1, LFY1 (gene) Pyrus elaeagrifolia

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus elaeagrifolia
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991432.1-LFY1Pyrus elaeagrifoliagene
LFY1GU991428.1-LFY1Pyrus elaeagrifoliagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus elaeagrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991432.1-LFY1 N/A GU991432.1
gene parsed from NCBI nr database GU991428.1-LFY1 scaffold00563:8432..9067
GU991428.1

Sequence(s):
>GU991432.1-LFY1649
tggacgttcatcaataaagaaaaagaccattacactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tggaccctaagcgttatctacacactcatttttacctctcacgcatcattctcaattcatggccgtcatatcgaatgaat
tgaaaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacactactaaaagcac
ctctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgtcgaatttaatacatgcggtctgaaaattttgtcaatttaagaatatctgtcaacttctgtgaatttcttgtatgaaa
tctgttaaatttatcctcgtataagaaatttacattgttgatgaatattctttgacttggaactactttcttacatcatg
agtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top
>GU991428.1-LFY1646
tggacgttcatcaataaagaaaaagactcttatactcatataaaattaccacaaagacttggtgattgtctaagaaaaac
aattatggggtttttttcactgtattcacctcattgatgcactttgttgttatggtatgcactagaaacttaggtagttg
aaccctaagtgttatctacacactcatttttacctctcacacatcattctcaattcatggccttcggatcaaatgaattg
aaaatgatcaattgaccaaaattaataagagtgtgtcagagataaaaagatgtgtgtgaaaagcactactaaaagcattt
ctttccggttatgaaccacacattttcaatcaatttagatttggcaaagtttcacttttgtttatgtattttcaattaca
tcgaatttaatacatgcggtctgcaaatttaatcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatc
tgttaaatttatcctcgtacaagaaatttacattgttgatgaatattctttgaattggaactactttcttatatcatgag
tcaaatttgatgcaatcgaaaatacatgaataaaagtaggtcagtttgtagtccaaattaatttgattcaactatttagt
tcgact
back to top