LFY1, LFY1 (gene) Pyrus hopeiensis

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus hopeiensis
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991406.1-LFY1Pyrus hopeiensisgene
LFY1GU991448.1-LFY1Pyrus hopeiensisgene
LFY1GU991447.1-LFY1Pyrus hopeiensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991406.1-LFY1.m1Pyrus hopeiensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus hopeiensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991406.1-LFY1 N/A GU991406.1
gene parsed from NCBI nr database GU991448.1-LFY1 N/A GU991448.1
gene parsed from NCBI nr database GU991447.1-LFY1 N/A GU991447.1
mRNA parsed from NCBI nr database GU991406.1-LFY1.m1 scaffold00563:9164..9571
GU991406.1

Sequence(s):
>GU991406.1-LFY11041
tgtcggaggagccagtgcaacaagaggaggagatggcggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaaca
attatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacccta
agcgttatctacacactcatttttacctctcacacatcattctcaattcacggccgtcatattgaatgaattgaaaaaga
tcaattgaccaaaattaataagaatgtgtcagagataaaagatgtgtgtgataaaaacgctactaaaagcacttctttcc
ggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaat
ttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgttaa
atttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgggtcaaat
ttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcgac
t
back to top
>GU991448.1-LFY1643
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacc
ctaagcgttatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaa
agatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacgctactaaaagcacttcttt
ccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcga
atttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtt
aaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
act
back to top
>GU991447.1-LFY1643
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacc
ctaagcgttatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaa
agatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacgctactaaaagcacttcttt
ccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcga
atttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtt
aaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
act
back to top
>GU991406.1-LFY1.m1395
tgtcggaggagccagtgcaacaagaggaggagatggcggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top