LFY1, LFY1 (gene) Pyrus pashia

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus pashia
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991459.1-LFY1Pyrus pashiagene
LFY1GU991458.1-LFY1Pyrus pashiagene
LFY1GU991436.1-LFY1Pyrus pashiagene
LFY1GU991435.1-LFY1Pyrus pashiagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus pashiagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991459.1-LFY1 N/A GU991459.1
gene parsed from NCBI nr database GU991458.1-LFY1 N/A GU991458.1
gene parsed from NCBI nr database GU991436.1-LFY1 N/A GU991436.1
gene parsed from NCBI nr database GU991435.1-LFY1 N/A GU991435.1

Sequence(s):
>GU991459.1-LFY1649
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tgaaccctaagcgttatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatatcgaatgaat
tgaaaaagatcaattgaccaaaattaataagaatgggtcagagataaaaagatgtgtgtgaaaaacactactaaaaacac
ttctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgtcgaatttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaa
tctgttaaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatg
agtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top
>GU991458.1-LFY1649
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tgaaccctaagcgttatctacacacttatttttacctctcacacgtcattctcaattcatagccgtcatatcgaatgaat
tgaaaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacactactaaaagcac
ttctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcacttttgtttatgtattttcaatta
cgtcgaatttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaa
tctgttaaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatg
agtcaaatttgatgcaaccgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top
>GU991436.1-LFY1649
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tgaaccctaagcattatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatatcgaatgaat
tgaaaaagatcaattgaccaaaattaataagaatgtgttagagataaaaagatgtgtgtgaaaaacactactaaaagcac
ttctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgttgaatttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaa
tctgttaaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatg
agtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top
>GU991435.1-LFY1649
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tgaaccctaagcattatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatatcgaatgaat
tgaaaaagatcaattgaccaaaattaataagaatgtgttagagataaaaagatgtgtgtgaaaaacactactaaaagcac
ttctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgttgaatttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaa
tctgttaaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatg
agtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top