LFY1, LFY1 (gene) Pyrus phaeocarpa

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus phaeocarpa
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991402.1-LFY1Pyrus phaeocarpagene
LFY1GU991401.1-LFY1Pyrus phaeocarpagene
LFY1GU991441.1-LFY1Pyrus phaeocarpagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991402.1-LFY1.m1Pyrus phaeocarpamRNA
LFY1GU991401.1-LFY1.m1Pyrus phaeocarpamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus phaeocarpagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991402.1-LFY1 N/A GU991402.1
gene parsed from NCBI nr database GU991401.1-LFY1 N/A GU991401.1
gene parsed from NCBI nr database GU991441.1-LFY1 N/A GU991441.1
mRNA parsed from NCBI nr database GU991402.1-LFY1.m1 scaffold00563:9164..9571
GU991402.1
mRNA parsed from NCBI nr database GU991401.1-LFY1.m1 scaffold00563:9164..9571
GU991401.1

Sequence(s):
>GU991402.1-LFY11042
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaata
attatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacccta
agcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaaaga
tcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacgctactaaaagcacttctttc
cggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa
tttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtta
aatttatcctcgtataagaaatttacattgttaatgaatattctttgaattggaactactttcttacatcatgagtcaaa
tttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcga
ct
back to top
>GU991401.1-LFY11042
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggccttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaata
attatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacccta
agcgttatctacacattcatttttacctcttacacatcattctcaattcatggccgtcatattgaatgaattgaaaaaga
tcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacgctactaaaagcacttcttac
cggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa
tttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgttg
aatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaaa
tttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcga
ct
back to top
>GU991441.1-LFY1643
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
ataattatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacc
ctaagcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaa
agatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacgctactaaaagcacttcttt
ccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcga
atttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtt
aaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
act
back to top
>GU991402.1-LFY1.m1395
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>GU991401.1-LFY1.m1395
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggccttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top