LFY1, LFY1 (gene) Pyrus pyrifolia

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus pyrifolia
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991417.1-LFY1Pyrus pyrifoliagene
LFY1GU991416.1-LFY1Pyrus pyrifoliagene
LFY1GU991415.1-LFY1Pyrus pyrifoliagene
LFY1GU991410.1-LFY1Pyrus pyrifoliagene
LFY1GU991407.1-LFY1Pyrus pyrifoliagene
LFY1GU991457.1-LFY1Pyrus pyrifoliagene
LFY1GU991455.1-LFY1Pyrus pyrifoliagene
LFY1GU991454.1-LFY1Pyrus pyrifoliagene
LFY1GU991449.1-LFY1Pyrus pyrifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991417.1-LFY1.m1Pyrus pyrifoliamRNA
LFY1GU991416.1-LFY1.m1Pyrus pyrifoliamRNA
LFY1GU991415.1-LFY1.m1Pyrus pyrifoliamRNA
LFY1GU991410.1-LFY1.m1Pyrus pyrifoliamRNA
LFY1GU991407.1-LFY1.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991417.1-LFY1 N/A GU991417.1
gene parsed from NCBI nr database GU991416.1-LFY1 N/A GU991416.1
gene parsed from NCBI nr database GU991415.1-LFY1 N/A GU991415.1
gene parsed from NCBI nr database GU991410.1-LFY1 N/A GU991410.1
gene parsed from NCBI nr database GU991407.1-LFY1 N/A GU991407.1
gene parsed from NCBI nr database GU991457.1-LFY1 N/A GU991457.1
gene parsed from NCBI nr database GU991455.1-LFY1 N/A GU991455.1
gene parsed from NCBI nr database GU991454.1-LFY1 N/A GU991454.1
gene parsed from NCBI nr database GU991449.1-LFY1 N/A GU991449.1
mRNA parsed from NCBI nr database GU991417.1-LFY1.m1 scaffold00563:9164..9571
GU991417.1
mRNA parsed from NCBI nr database GU991416.1-LFY1.m1 scaffold00563:9164..9571
GU991416.1
mRNA parsed from NCBI nr database GU991415.1-LFY1.m1 scaffold00563:9164..9571
GU991415.1
mRNA parsed from NCBI nr database GU991410.1-LFY1.m1 scaffold00563:9164..9571
GU991410.1
mRNA parsed from NCBI nr database GU991407.1-LFY1.m1 scaffold00563:9164..9571
GU991407.1

Sequence(s):
>GU991417.1-LFY11048
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaggaaggggcaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaaca
attatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagttga
accctaagcgttatctacacacttatttttacctctcacacgtcattctcaattcatagccgtcatatcgaatgaattga
aaaagatcaattaaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacactactaaaagcact
tctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattac
gtcgaatttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaat
ttgttaaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatga
gtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattta
gttcgact
back to top
>GU991416.1-LFY11048
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggaaggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggaggcggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaaca
attatggggtttttttcactgtattcacctcattgatgcaccctgttgttatggtatgcactagaaacttaggtagttga
accctaagcgttatctacacacttatttttacctctcacacgtcattctcaattcatagccgtcatatcgaatgaattga
aaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacactactaaaagcact
tctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattac
gtcgaatttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaat
ttgttaaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatga
gtcaaatttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactattta
gttcgact
back to top
>GU991415.1-LFY11048
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggaaggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggaggcggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaaca
attatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagttga
accctaagcgttatctacacacttatttttacctctcacacgtcattctcaattcatagccgtcatatcgaatgaattga
aaaagatcaattaaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacactactaaaagcact
tctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattac
gtcgaatttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaat
ttgttaaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatga
gtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattta
gttcgact
back to top
>GU991410.1-LFY11042
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaata
attatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacccta
agcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaaaga
tcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacgctactaaaagcacttctttc
cggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa
tttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtta
aatttagcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaaa
tttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactatttagttcga
ct
back to top
>GU991407.1-LFY11042
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataagattaccacaaagacttggtgattgtctaagaaaaaca
attatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacccta
agcgttatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaaata
tcaattaaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacgctactaaaagcacttctttc
cggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa
tttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttctgtgaatttcttgtatgaaatctgtta
aatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgtgtcaaa
tttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcga
ct
back to top
>GU991457.1-LFY1649
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tgaaccctaagcgttatctacacacttatttttacctctcacacgtcattctcaattcatagccgtcatatcgaatgaat
tgaaaaagatcaattaaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacactactaaaagcac
ttctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgtcgaatttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaa
tttgttaaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatg
agtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top
>GU991455.1-LFY1649
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acgattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tgaaccctaagcgttatctacacacttatttttacctctcatacgtcattctcaattcatagccgtcatatcgaatgaat
tgaaaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacactactaaaagcac
ttctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgtcgaatttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaa
tttgttaaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatg
agtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top
>GU991454.1-LFY1643
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
ataattatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacc
ctaagcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaa
agatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacgctactaaaagcacttcttt
ccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcga
atttaatacatgcagtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatttgtt
aaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
act
back to top
>GU991449.1-LFY1643
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacc
ctaagcgttatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaa
atatcaattaaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacgctactaaaagcacttcttt
ccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcga
atttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttctgtgaatttcttgtatgaaatctgtt
aaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
act
back to top
>GU991417.1-LFY1.m1395
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaggaaggggcaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>GU991416.1-LFY1.m1395
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggaaggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggaggcggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>GU991415.1-LFY1.m1395
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggaaggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggaggcggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>GU991410.1-LFY1.m1395
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>GU991407.1-LFY1.m1395
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top