LFY1, LFY1 (gene) Pyrus serrulata

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus serrulata
Synonym LEAFY 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991419.1-LFY1Pyrus serrulatagene
LFY1GU991411.1-LFY1Pyrus serrulatagene
LFY1GU991404.1-LFY1Pyrus serrulatagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991419.1-LFY1.m1Pyrus serrulatamRNA
LFY1GU991411.1-LFY1.m1Pyrus serrulatamRNA
LFY1GU991404.1-LFY1.m1Pyrus serrulatamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus serrulatagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991419.1-LFY1 N/A GU991419.1
gene parsed from NCBI nr database GU991411.1-LFY1 N/A GU991411.1
gene parsed from NCBI nr database GU991404.1-LFY1 N/A GU991404.1
mRNA parsed from NCBI nr database GU991419.1-LFY1.m1 scaffold00563:9164..9571
GU991419.1
mRNA parsed from NCBI nr database GU991411.1-LFY1.m1 scaffold00563:9164..9571
GU991411.1
mRNA parsed from NCBI nr database GU991404.1-LFY1.m1 scaffold00563:9164..9571
GU991404.1

Sequence(s):
>GU991419.1-LFY11048
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaaca
attatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagttga
accctaagcgttatctacacacttatttttacctctcacacgtcattctcaattcatagccgtcatatcgaatgaattga
aaaagatcaattgaccagaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacactactaaaagcact
tctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcaccttcgtttatgtattttcaattac
gtcgaatttaatacatgcagtctcaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtgtgaaat
ttgttaaatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatga
gtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattta
gttcgact
back to top
>GU991411.1-LFY11042
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgttcatcaataaagaaaaagactactatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaata
attatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacccta
agcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaaaga
tcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacgctactaaaagcacttctttc
cggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa
tttaatacatgcagtctcaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatttgtta
aatttatccttgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaaa
tttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactatttagttcga
ct
back to top
>GU991404.1-LFY11042
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggttgg
acgctcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaaata
attatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacccta
agcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaaaga
tcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgataaaaacgctactaaaagcacttctttc
cggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcgaa
tttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtta
aatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcacgagtcaaa
tttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcga
ct
back to top
>GU991419.1-LFY1.m1395
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>GU991411.1-LFY1.m1395
tgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top
>GU991404.1-LFY1.m1395
tgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtagggatggcgtgggaggttgtgacggcgggg
gagaggcggaagaagcagcggaggatgaagaagggccaatataggaactgtagtgctggagggggtcataataatgatca
taacgagggtgtagacgacaaggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacaga
gggagcacccgttcatcgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctc
tacgagcagtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaag
back to top