LFY1, LFY1 (gene) Pyrus sinkiangensis

Gene Overview
Name LFY1
Gene Symbol LFY1
Type gene
Organism Pyrus sinkiangensis
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFY1GU991460.1-LFY1Pyrus sinkiangensisgene
LFY1GU991440.1-LFY1Pyrus sinkiangensisgene
LFY1GU991439.1-LFY1Pyrus sinkiangensisgene
LFY1GU991438.1-LFY1Pyrus sinkiangensisgene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYPyrus sinkiangensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU991460.1-LFY1 N/A GU991460.1
gene parsed from NCBI nr database GU991440.1-LFY1 N/A GU991440.1
gene parsed from NCBI nr database GU991439.1-LFY1 N/A GU991439.1
gene parsed from NCBI nr database GU991438.1-LFY1 N/A GU991438.1

Sequence(s):
>GU991460.1-LFY1649
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
acaattatggggtttttttcactgtattcacctcattgatgcaccttgttgttatggtatgcactagaaacttaggtagt
tgaaccctaagcgttatctacacactcatttttacctctcacacatcattctcaattcatggccgtcatatcgaatgaat
tgaaaaagatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacactactaaaaacac
ttctttccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaatta
cgtcgaatttaatacatggggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaa
tctgttaaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatg
agtcaaatttgatgcaatcgaaaatacatgaatgaaagtaggtcagtttgtagtccaaaagtaatttgattcaactattt
agttcgact
back to top
>GU991440.1-LFY1643
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
ataattatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacc
ctaagcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaa
agatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacgctactaaaagcacttcttt
ccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcga
atttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtt
aaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
act
back to top
>GU991439.1-LFY1643
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
ataattatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacc
ctaagcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaa
agatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacgctactaaaagcacttcttt
ccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcga
atttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtt
aaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
act
back to top
>GU991438.1-LFY1643
tggacgttcatcaataaagaaaaagactattatactcatatataaaattaccacaaagacttggtgattgtctaagaaaa
ataattatggggtttttttcactgtattcacctcattgatgcaccttgttgtatgcactagaaacttaggtagttgaacc
ctaagcgttatctacacattcatttttacctctcacacatcattctcaattcatggccgtcatattgaatgaattgaaaa
agatcaattgaccaaaattaataagaatgtgtcagagataaaaagatgtgtgtgaaaaacgctactaaaagcacttcttt
ccggttatgaacaacacattttcaatcaatttagatttggcaaagtttcactttcgtttatgtattttcaattacgtcga
atttaatacatgcggtctgaaaattttgtcaatttaagaatatccgtcaacttccgtgaatttcttgtatgaaatctgtt
aaatttatcctcgtataagaaatttacattgttgatgaatattctttgaattggaactactttcttacatcatgagtcaa
atttgatgcaatccaaaatacatgaatgaaagtaagtcagtttgtagtccaaaagtaatttgattcaactatttagttcg
act
back to top