LFY, LFY (gene) Crataegus brachyacantha

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus brachyacantha
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500512.1-LFYCrataegus brachyacanthagene
LFYEU500511.1-LFYCrataegus brachyacanthagene
LFYEU683941.1-LFYCrataegus brachyacanthagene
LFYEF127069.1-LFYCrataegus brachyacanthagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500512.1-LFY.m1Crataegus brachyacanthamRNA
LFYEU500511.1-LFY.m1Crataegus brachyacanthamRNA
LFYEU683941.1-LFY.m1Crataegus brachyacanthamRNA
LFYEF127069.1-LFY.m1Crataegus brachyacanthamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus brachyacanthagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500512.1-LFY N/A EU500512.1
gene parsed from NCBI nr database EU500511.1-LFY N/A EU500511.1
gene parsed from NCBI nr database EU683941.1-LFY N/A EU683941.1
gene parsed from NCBI nr database EF127069.1-LFY N/A EF127069.1
mRNA parsed from NCBI nr database EU500512.1-LFY.m1 N/A EU500512.1
mRNA parsed from NCBI nr database EU500511.1-LFY.m1 N/A EU500511.1
mRNA parsed from NCBI nr database EU683941.1-LFY.m1 N/A EU683941.1
mRNA parsed from NCBI nr database EF127069.1-LFY.m1 N/A EF127069.1

Sequence(s):
>EU500512.1-LFY1047
gaagcagccgtaacgccagcagcggcagctgcggcggcggcggctcgttatactttgccgccgccaagagagcttggact
tggagggcttgaagacttgttccaggcttatggggtcagatactacacggcggcgaacatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttaatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatatacatgaac
attttttacctttgtgtcttagattaaccgtagtatatatataggcgtatacgtagggtttgattacaccttgaaataac
attattttacatgtaaattaatagtgtgacgatataacatgttcaaatagatgataaaaaaaaaatagaatttagtgaat
caaagaagaaaaataggtcgcaaaacataaaaacttttgtcctttggtgtaataatttgatggaaataacaaatcaaata
tgtttattattttgtgacataatatgtcagatcataagatgttcgagattgcgtgataaaactaaaagcatatgttttat
atgattgtaacataatatgtcaattatcatagtctttgatactagaacataaagtaattgttatattagattgggatata
tgacacgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtag
ggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgt
agtgctggagggggtcataataatgatcataacgtgggtgtagacgacaaggacgacgacatgaatgggcaggggaacgg
tggagga
back to top
>EU500511.1-LFY1044
gaagcagccgtaacgccagcagcggcagctgcggcggctgcggctcgttatactttgccgccgccaagagagcttggact
tggagggcttgaagacttgttccaggcttatggggtcagatactacactgcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttaatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatatacatgaac
attttttacctttgtgtcttagattaaccgtagtatataggcgtataggtagggtttgattacaccttgaaataacatta
ttttacatgtaaattaatagtgtgacgatataacatgttcaaatagatgataaaaaaagaaatagaatttagtgaatcaa
agaagaaaaataggtcgcaaaacataaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaatatgt
ttattattttgtgacataatatgtcagatcataagatgttcgagattgcgtgataaaactaaaagcatatgttttatatg
attgtaacataatatgtcaattatcgtagtctttgatactagaacataaagtaattgttatattagattgggatatatga
cacgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagaggaggagatggtggggagcggagtaggga
tggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggtactgtagt
gctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatgaatgggcaggggaacggtgg
agga
back to top
>EU683941.1-LFY622
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagttttacccatct
cccttcttacgtacgctgatttctactgtggcaattaattaacagtaaaaactctaatgttagtcattgaaatcaacaca
aatattaaatggtcgcgtttgtaatggttttagttctatagtttccacatagttatagtttccttcatgtattgcaagtc
gcatcgacataactcccgacaatttgcaaatcgctgtaattcgaaggcacccgtcaaattttgttgaattcttgtatgaa
gtcggtcaaatttaccatttcgtgtaccacatgcataacgatcaggtacaaggtattaacggaagttgaggtttagggat
gacctcgagttggaacaaaatgtataatttcgttttgcatttgtttactctttacattatattacatatgcaggtgacaa
accaagtgtttaggtatgccaaaaaggcaggggcaagctacatcaacaaacccaaaatgcgc
back to top
>EF127069.1-LFY623
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagttttacccatc
tcccttcttacgtacgctgatttctactgtggcaattaattaacagtaaaaactctaatgttagtcattgaaatcaacac
aaatattaaatggtcgcgtttgtaatggttttagttctatagtttccacatagttatagtttccttcatgtattgcaagt
ctcatctacttaactcccgacaatttgcaaatcgctgtaattcgaaggcacccgtcaaattttgttgaattcttgtatga
agtcggtcaaatttaccatttcgtgtaccacatgcataacgatctggtacaaggtattaacggaagttgaggtttaggga
tgacctcgagttggaacaaaatgtataatttcgttttgcatttgtttactctttacattatattacatatgcaggtgaca
aaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatcaacaagcccaagatgcgc
back to top
>EU500512.1-LFY.m1579
gaagcagccgtaacgccagcagcggcagctgcggcggcggcggctcgttatactttgccgccgccaagagagcttggact
tggagggcttgaagacttgttccaggcttatggggtcagatactacacggcggcgaacatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttaatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagaggaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgtgggtgtagacgacaaggacgacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU500511.1-LFY.m1579
gaagcagccgtaacgccagcagcggcagctgcggcggctgcggctcgttatactttgccgccgccaagagagcttggact
tggagggcttgaagacttgttccaggcttatggggtcagatactacactgcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttaatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagaggaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggtactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU683941.1-LFY.m1209
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgtttag
gtatgccaaaaaggcaggggcaagctacatcaacaaacccaaaatgcgc
back to top
>EF127069.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaagcccaagatgcgc
back to top