LFY, LFY (gene) Crataegus calpodendron

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus calpodendron
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500504.1-LFYCrataegus calpodendrongene
LFYEU683937.1-LFYCrataegus calpodendrongene
LFYEF127055.1-LFYCrataegus calpodendrongene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500504.1-LFY.m1Crataegus calpodendronmRNA
LFYEU683937.1-LFY.m1Crataegus calpodendronmRNA
LFYEF127055.1-LFY.m1Crataegus calpodendronmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus calpodendrongene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500504.1-LFY N/A EU500504.1
gene parsed from NCBI nr database EU683937.1-LFY N/A EU683937.1
gene parsed from NCBI nr database EF127055.1-LFY N/A EF127055.1
mRNA parsed from NCBI nr database EU500504.1-LFY.m1 N/A EU500504.1
mRNA parsed from NCBI nr database EU683937.1-LFY.m1 N/A EU683937.1
mRNA parsed from NCBI nr database EF127055.1-LFY.m1 N/A EF127055.1

Sequence(s):
>EU500504.1-LFY1057
gaaccacccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcatatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattatattacatgtaaattaatagtgtgataatataacatgttcaaacagatgataaaaaagaattagaatttagtgaa
tcaaagaagaaaaataggtcgcaaaactttaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaag
atgtttattattttgtgacatactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgtttta
tatgattgtaacataatatgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatat
atgacacgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagta
gggatggcgtgggaggttgtgacgacgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactg
tagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggc
aggggaacggtggagga
back to top
>EU683937.1-LFY418
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtttttacccatc
tcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtacgaagtccgtcaaatttac
catttcgtgtaccacatacataacgatctggtgcaaggtattaacggaagttggaacaaaatgtataatttcgttttgca
tttgtttactctttacattatatatgcaggtgacaaatcaagtgtttaggtatgccaaaaaggcaggggcaagctacatc
aacaagcccaaaatgcgc
back to top
>EF127055.1-LFY419
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtttttacccat
ctcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtacgaagtccgtcaaattta
ccatttcgtgtaccacatacataacgatctggtrcaaggtattaacggaagttggaacaaaatgtataatttcgttttgc
atttgtttgctctttacattatatatgcaggtgacaaatcaagtgtttaggtatgccaaaaaggcaggggcaagctacat
caacaagcccaaratgcgc
back to top
>EU500504.1-LFY.m1588
gaaccacccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcatatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacgacgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
catgaatgggcaggggaacggtggagga
back to top
>EU683937.1-LFY.m1209
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaatcaagtgtttag
gtatgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top
>EF127055.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaatcaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaagcccaaratgcgc
back to top