LFY, LFY (gene) Crataegus cf. flava 2003_46

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus cf. flava 2003_46
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500489.1-LFYCrataegus cf. flava 2003_46gene
LFYEU500542.1-LFYCrataegus cf. flava 2003_46gene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500489.1-LFY.m1Crataegus cf. flava 2003_46mRNA
LFYEU500542.1-LFY.m1Crataegus cf. flava 2003_46mRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus cf. flava 2003_46gene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500489.1-LFY N/A EU500489.1
gene parsed from NCBI nr database EU500542.1-LFY N/A EU500542.1
mRNA parsed from NCBI nr database EU500489.1-LFY.m1 N/A EU500489.1
mRNA parsed from NCBI nr database EU500542.1-LFY.m1 N/A EU500542.1

Sequence(s):
>EU500489.1-LFY1057
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggaggttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttacatgtaaattaatagtgtgacaatataacatgttcaaccagatgataaaaaagaattagaatttagtgaa
tcaaagaagaaaaataggtcgcaaaacattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaag
atgtttattattttgtgacatactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgtttta
tatgattgtaacataatatgtcaattatcgtagtctttgataatagaacataaagtagttgttatattagattgggatat
atgacacgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagta
gggatggagtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactg
tagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgatatgaatgggc
aggggaacggtggagga
back to top
>EU500542.1-LFY440
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagttttacccatct
cccctctttacgtacgctgatttctactgtggccattaattaacagtaaaaattcttgtatgaagtccgtcaaatttacc
atttcgtgtacacatacataacgatctggtacaagatattaacggaagttgaggtttagggatgtcctcgagttggaaca
aaatgtataatttcgttttgcatttgtttgctctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaa
aaaggcaggggcaagctacatcaacaaacccaaaatgagc
back to top
>EU500489.1-LFY.m1588
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggaggttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggagtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
tatgaatgggcaggggaacggtggagga
back to top
>EU500542.1-LFY.m1209
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaaccaagtgtttag
gtatgccaaaaaggcaggggcaagctacatcaacaaacccaaaatgagc
back to top