LFY, LFY (gene) Crataegus cf. flava 2003_52

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus cf. flava 2003_52
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500501.1-LFYCrataegus cf. flava 2003_52gene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500501.1-LFY.m1Crataegus cf. flava 2003_52mRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus cf. flava 2003_52gene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500501.1-LFY N/A EU500501.1
mRNA parsed from NCBI nr database EU500501.1-LFY.m1 N/A EU500501.1

Sequence(s):
>EU500501.1-LFY1051
gaagcagccgtaacgccagtagcggcatctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcagagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttatatgtaaattaatagtgtgacaatataacatgttcaaacagaaaaagaattagaatttagtgaatcaaag
aagaaaaataggtcgcaaaacattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaagatgttt
attattttgtgacatactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgttttatatgat
tgtaacataatatgtcaattatcgtagtctttgatactagaacataacatagttgttatattagattgggatatatgaca
cgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatg
gcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgc
tggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggcagggga
acggtggagga
back to top
>EU500501.1-LFY.m1588
gaagcagccgtaacgccagtagcggcatctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcagagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
catgaatgggcaggggaacggtggagga
back to top