LFY, LFY (gene) Crataegus crus-galli

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus crus-galli
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500507.1-LFYCrataegus crus-galligene
LFYEF127047.1-LFYCrataegus crus-galligene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500507.1-LFY.m1Crataegus crus-gallimRNA
LFYEF127047.1-LFY.m1Crataegus crus-gallimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus crus-galligene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500507.1-LFY N/A EU500507.1
gene parsed from NCBI nr database EF127047.1-LFY N/A EF127047.1
mRNA parsed from NCBI nr database EU500507.1-LFY.m1 N/A EU500507.1
mRNA parsed from NCBI nr database EF127047.1-LFY.m1 N/A EF127047.1

Sequence(s):
>EU500507.1-LFY1052
gaagcagccgtaacgccagtagctgcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttacatgtaaattaatagtgtgacaatataacatgttcaaacagaaaaaagaattagaatttagtgaatcaaa
gaagaaaaataggtcgcaaaacattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaagatgtt
tattattttgtgacatactatgccagatcataagatgttcgagattgcgtgataagactaaaagcatatgttttatatga
ttgtaacataatatgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatatatgac
acgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggat
ggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatacaggaactgtactg
ctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggcagggg
aacggtggagga
back to top
>EF127047.1-LFY418
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagttttacccatc
tcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtacgaagtccgtcaaatttac
catttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatgtataatttcgttttgca
tttgtttgctctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatc
aacaagcccaaaatgcgc
back to top
>EU500507.1-LFY.m1588
gaagcagccgtaacgccagtagctgcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tacaggaactgtactgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
catgaatgggcaggggaacggtggagga
back to top
>EF127047.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top