LFY, LFY (gene) Crataegus dodgei

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus dodgei
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500522.1-LFYCrataegus dodgeigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500522.1-LFY.m1Crataegus dodgeimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus dodgeigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500522.1-LFY N/A EU500522.1
mRNA parsed from NCBI nr database EU500522.1-LFY.m1 N/A EU500522.1

Sequence(s):
>EU500522.1-LFY417
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagttttacccgtct
cccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaagttcttgtacgaagtccgtcaaatttacc
atttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatgtataatttccttttgcat
ttgtttactctttacattatatatgcaggtgacaaaccaagcgtttaggtatgccaaaaaggcaggggcaagctacatca
acaagcccaaaatgcgc
back to top
>EU500522.1-LFY.m1209
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagcgtttag
gtatgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top