LFY, LFY (gene) Crataegus mollis

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus mollis
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500494.1-LFYCrataegus mollisgene
LFYEF127049.1-LFYCrataegus mollisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500494.1-LFY.m1Crataegus mollismRNA
LFYEF127049.1-LFY.m1Crataegus mollismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus mollisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500494.1-LFY N/A EU500494.1
gene parsed from NCBI nr database EF127049.1-LFY N/A EF127049.1
mRNA parsed from NCBI nr database EU500494.1-LFY.m1 N/A EU500494.1
mRNA parsed from NCBI nr database EF127049.1-LFY.m1 N/A EF127049.1

Sequence(s):
>EU500494.1-LFY1052
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactattcgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttatatgtaaattaatagtgtgacaatataacatgttcaaacagaaaaaagaattagaatttagtgaatcaaa
gaagaaaaataggtcgcaaagcattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaagatgtt
tattattttgtgacatactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgttttatatga
ttgtaacataatatgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatatatgac
acgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggat
ggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtg
ctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggcagggg
aacggtggagga
back to top
>EF127049.1-LFY421
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagttttacccatc
tcccctctttacgtacgctgatgatttctactgtggcaattaattaacagtaaaaattcttgtacgaagtccgtcaaatt
taccatttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatgtataatttcgtttt
gcatttgtttgctctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctac
atcaacaaacccaaaatgcgc
back to top
>EU500494.1-LFY.m1588
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
catgaatgggcaggggaacggtggagga
back to top
>EF127049.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaaacccaaaatgcgc
back to top