LFY, LFY (gene) Crataegus nigra

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus nigra
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU683936.1-LFYCrataegus nigragene
LFYEF127044.1-LFYCrataegus nigragene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU683936.1-LFY.m1Crataegus nigramRNA
LFYEF127044.1-LFY.m1Crataegus nigramRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus nigragene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU683936.1-LFY N/A EU683936.1
gene parsed from NCBI nr database EF127044.1-LFY N/A EF127044.1
mRNA parsed from NCBI nr database EU683936.1-LFY.m1 N/A EU683936.1
mRNA parsed from NCBI nr database EF127044.1-LFY.m1 N/A EF127044.1

Sequence(s):
>EU683936.1-LFY1038
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaacaaggtactatgaatattatttaccctt
gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattacactttgaaataacattatttacatgtaaat
taatagtgcgacaaaataacatgttcaaacagatgataaaaaagaattagaatttagtgaatcaaagaagaaaaatagtt
cgcaaaacattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaagatgtttattattctgtgac
atactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgttttatatgattgtaacataatat
gtcaattatcgtagtctttgatactagaacataaagttgttgttatattagattgggatatatgacacgctgtgcatggg
atgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttg
tgacggcgggggagaggcggaagaagcagcggagggtgaagaaggggcaatataggaactgtagtgctggagggggtcat
aataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EF127044.1-LFY345
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggtctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagtttcacccgtc
tcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtatgaagtccatcaaatttcc
ttttgcatttgtttactctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcgggggcaag
ctacatcaacaaacccaaaatgcgc
back to top
>EU683936.1-LFY.m1591
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaacaaccagtgcaacaagagaaggagatgg
tggggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggagggtgaagaagggg
caatataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatgga
cgacatgaatgggcaggggaacggtggagga
back to top
>EF127044.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggtctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcgggggcaagctacatcaacaaacccaaaatgcgc
back to top