LFY, LFY (gene) Crataegus opaca

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus opaca
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500499.1-LFYCrataegus opacagene
LFYEU683947.1-LFYCrataegus opacagene
LFYEF127059.1-LFYCrataegus opacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500499.1-LFY.m1Crataegus opacamRNA
LFYEU683947.1-LFY.m1Crataegus opacamRNA
LFYEF127059.1-LFY.m1Crataegus opacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus opacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500499.1-LFY N/A EU500499.1
gene parsed from NCBI nr database EU683947.1-LFY N/A EU683947.1
gene parsed from NCBI nr database EF127059.1-LFY N/A EF127059.1
mRNA parsed from NCBI nr database EU500499.1-LFY.m1 N/A EU500499.1
mRNA parsed from NCBI nr database EU683947.1-LFY.m1 N/A EU683947.1
mRNA parsed from NCBI nr database EF127059.1-LFY.m1 N/A EF127059.1

Sequence(s):
>EU500499.1-LFY1038
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttgggct
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctatatgctctctcccaacaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttatatgtaaattaatagtttgacaaacagaaaaaagaattagaatttagtgaatcaaagaagaaaaataggt
cgcaaatcattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaagatgtttattattttgtgac
atactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgttttatatgattgtaacataatat
gtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatatatgacacgctgtgcatggg
atgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggttg
tgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactgtagtgctggagggggtcat
aataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EU683947.1-LFY417
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagttttacccatct
cccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattctcstatgaagtccgtcaaatttacc
atttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatgtataacttcgttttgcat
ttgtttactgtttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatca
acaagcccaaratgcgc
back to top
>EF127059.1-LFY418
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagttttacccatc
tcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattctcgtacgaagtccgtcaaatttac
catttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatgtataacttcgttttgca
tttgtttactgtttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatc
aacaagcccaaratgcgc
back to top
>EU500499.1-LFY.m1588
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttgggct
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctatatgctctctcccaacaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
catgaatgggcaggggaacggtggagga
back to top
>EU683947.1-LFY.m1209
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaaccaagtgtttag
gtatgccaaaaaggcaggggcaagctacatcaacaagcccaaratgcgc
back to top
>EF127059.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaagcccaaratgcgc
back to top