LFY, LFY (gene) Crataegus pubescens

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus pubescens
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500492.1-LFYCrataegus pubescensgene
LFYEF127058.1-LFYCrataegus pubescensgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500492.1-LFY.m1Crataegus pubescensmRNA
LFYEF127058.1-LFY.m1Crataegus pubescensmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus pubescensgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500492.1-LFY N/A EU500492.1
gene parsed from NCBI nr database EF127058.1-LFY N/A EF127058.1
mRNA parsed from NCBI nr database EU500492.1-LFY.m1 N/A EU500492.1
mRNA parsed from NCBI nr database EF127058.1-LFY.m1 N/A EF127058.1

Sequence(s):
>EU500492.1-LFY1057
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttaccg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttgtgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttacatataaattaatagtgtgacaatttaacatgttcaaacagatgataaaaaagaattagaatttagtgaa
tcaaagaagaaaaatagttcgcaaaacattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaag
atgtttattattttgtgacatactatgccagatcataagatgttcgagattgcgttataaaactaaaagcatatgtttta
tatgattgtaacataatatgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatat
atgacacgctgcgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagta
gggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactg
tagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggc
aggggaacggtggagga
back to top
>EF127058.1-LFY418
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagttttactcatc
tcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtacgaagtccgtcaaatttac
catttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatgtataatttcgttttgca
tttgtttactctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatc
aacaagcccaaratgcsc
back to top
>EU500492.1-LFY.m1588
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttaccg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
catgaatgggcaggggaacggtggagga
back to top
>EF127058.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaagcccaaratgcsc
back to top