LFY, LFY (gene) Crataegus sp. 2002_05

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus sp. 2002_05
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500483.1-LFYCrataegus sp. 2002_05gene
LFYEU500528.1-LFYCrataegus sp. 2002_05gene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500483.1-LFY.m1Crataegus sp. 2002_05mRNA
LFYEU500528.1-LFY.m1Crataegus sp. 2002_05mRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus sp. 2002_05gene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500483.1-LFY N/A EU500483.1
gene parsed from NCBI nr database EU500528.1-LFY N/A EU500528.1
mRNA parsed from NCBI nr database EU500483.1-LFY.m1 N/A EU500483.1
mRNA parsed from NCBI nr database EU500528.1-LFY.m1 N/A EU500528.1

Sequence(s):
>EU500483.1-LFY1057
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcctagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttacatgtaaattaatagtgtgacaatataacatgttcaaacagatgataaaaaagaattagaatttagtgaa
tcaaagaagaaaaatagttcgcaaaacattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaag
atgtttattattttgtgacatactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgtttta
tatgattgtaacataatatgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatat
atgacacgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagta
gggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactg
tagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgacatgaatgggc
aggggaaccctggagga
back to top
>EU500528.1-LFY417
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagttttacccatct
cccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtacgaagtccgtcaaatttacc
atttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatgtataatttcgttttgcat
ttgtttgctctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatca
acaaacccaaaatgagc
back to top
>EU500483.1-LFY.m1588
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
catgaatgggcaggggaaccctggagga
back to top
>EU500528.1-LFY.m1209
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaaccaagtgtttag
gtatgccaaaaaggcaggggcaagctacatcaacaaacccaaaatgagc
back to top