LFY, LFY (gene) Crataegus suksdorfii

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus suksdorfii
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500476.1-LFYCrataegus suksdorfiigene
LFYEU500473.1-LFYCrataegus suksdorfiigene
LFYEU500472.1-LFYCrataegus suksdorfiigene
LFYEU500470.1-LFYCrataegus suksdorfiigene
LFYEU500469.1-LFYCrataegus suksdorfiigene
LFYEU500468.1-LFYCrataegus suksdorfiigene
LFYEU500467.1-LFYCrataegus suksdorfiigene
LFYEU683940.1-LFYCrataegus suksdorfiigene
LFYEU683939.1-LFYCrataegus suksdorfiigene
LFYEF127063.1-LFYCrataegus suksdorfiigene
LFYEF127062.1-LFYCrataegus suksdorfiigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500476.1-LFY.m1Crataegus suksdorfiimRNA
LFYEU500473.1-LFY.m1Crataegus suksdorfiimRNA
LFYEU500472.1-LFY.m1Crataegus suksdorfiimRNA
LFYEU500470.1-LFY.m1Crataegus suksdorfiimRNA
LFYEU500469.1-LFY.m1Crataegus suksdorfiimRNA
LFYEU500468.1-LFY.m1Crataegus suksdorfiimRNA
LFYEU500467.1-LFY.m1Crataegus suksdorfiimRNA
LFYEU683940.1-LFY.m1Crataegus suksdorfiimRNA
LFYEU683939.1-LFY.m1Crataegus suksdorfiimRNA
LFYEF127063.1-LFY.m1Crataegus suksdorfiimRNA
LFYEF127062.1-LFY.m1Crataegus suksdorfiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus suksdorfiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500476.1-LFY N/A EU500476.1
gene parsed from NCBI nr database EU500473.1-LFY N/A EU500473.1
gene parsed from NCBI nr database EU500472.1-LFY N/A EU500472.1
gene parsed from NCBI nr database EU500470.1-LFY N/A EU500470.1
gene parsed from NCBI nr database EU500469.1-LFY N/A EU500469.1
gene parsed from NCBI nr database EU500468.1-LFY N/A EU500468.1
gene parsed from NCBI nr database EU500467.1-LFY N/A EU500467.1
gene parsed from NCBI nr database EU683940.1-LFY N/A EU683940.1
gene parsed from NCBI nr database EU683939.1-LFY N/A EU683939.1
gene parsed from NCBI nr database EF127063.1-LFY N/A EF127063.1
gene parsed from NCBI nr database EF127062.1-LFY N/A EF127062.1
mRNA parsed from NCBI nr database EU500476.1-LFY.m1 N/A EU500476.1
mRNA parsed from NCBI nr database EU500473.1-LFY.m1 N/A EU500473.1
mRNA parsed from NCBI nr database EU500472.1-LFY.m1 N/A EU500472.1
mRNA parsed from NCBI nr database EU500470.1-LFY.m1 N/A EU500470.1
mRNA parsed from NCBI nr database EU500469.1-LFY.m1 N/A EU500469.1
mRNA parsed from NCBI nr database EU500468.1-LFY.m1 N/A EU500468.1
mRNA parsed from NCBI nr database EU500467.1-LFY.m1 N/A EU500467.1
mRNA parsed from NCBI nr database EU683940.1-LFY.m1 N/A EU683940.1
mRNA parsed from NCBI nr database EU683939.1-LFY.m1 N/A EU683939.1
mRNA parsed from NCBI nr database EF127063.1-LFY.m1 N/A EF127063.1
mRNA parsed from NCBI nr database EF127062.1-LFY.m1 N/A EF127062.1

Sequence(s):
>EU500476.1-LFY1030
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatgaatattatttaccctt
gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattacaccttgaaataacattattttacatgtaaa
ttaatagtgcgacaaaataacatgttcaaacagatgataaaaaaaaattagaatttagtgaatcaaagaagaaaaatagg
tcgcaaaacattaaaacttttggcctttggggtaataatttgatggaaataacaaatcaaagatgtttattattttgtga
catactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcataagttttatatgattgtaacataata
tgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatgtatgacacgctgtgcatgg
gatgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggtt
gtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaatttaggaacagtagtgctggagggggtca
taataatgatcataacgagggtgtagacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EU500473.1-LFY1030
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttgtactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatgaatattatttaccctt
gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattacactttgaaataacattattttacatgtaaa
ttaatagtgcgacaaaataacatgttcaaacagatgataaaaaaaaattagaatttagtggatcaaagaagaaaaatagg
tcgcaaaacattaaaacttttggcctttggggtaataatttgatggaaataacaaatcaaagatgtttattattttgtga
catactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcataagttttatatgattgtaacataata
tgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatgtatgacacgctgtgcatgg
gatgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggtt
gtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaatttaggaacagtagtgctggagggggtca
taataatgatcataacgagggtgtagacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EU500472.1-LFY1030
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttgtactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatgaatattatttaccctt
gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattacactttgaaataacattattttacatgtaaa
ttaatagtgcgacaaaataacatgttcaaacagatgataaaaaaaaattagaatttagtggatcaaagaagaaaaatagg
tcgcaaaacattaaaacttttggcctttggggtaataatttgatggaaataacaaatcaaagatgtttattattttgtga
catactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcataagttttatatgattgtaacataata
tgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatgtatgacacgctgtgcatgg
gatgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggtt
gtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaatttaggaacagtagtgctggagggggtca
taataatgatcataacgagggtgtagacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EU500470.1-LFY1030
gaaccagccgtaacgccattagccgcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaaaacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactatgaatattatttaccctt
gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattacactttgaaataacattattttacatgtaaa
ttaatagtgcgacaaaataacatgttcaaacagatgataaaaaaaaattagaatttagtgaatcaaagaagaaaaatagg
tcgcaaaacattaaaacttttggcctttggggtaataatttgatggaaataacaaatcaaagatgtttattattttgtga
catactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcataagttttatatgattgtaacataata
tgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatgtatgacacgctgtgcatgg
gatgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggtt
gtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaatttaggaacagtagtgctggagggggtca
taataatgatcataacgagggtgtagacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EU500469.1-LFY1030
gaaccacccgtaacgccagtaccggcatctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgatcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctacatgctctctcccaagaaggtactatgaatattatttaccctt
gtgtcttatattaaccgtagtatataggcatacaggtagggtttgattacactttgaaataacattattttacatgtaaa
ttaatagtgcgacaaaataacatgttcaaacagatgataaaaaaaaattagaatttagtgaatcaaagaagaaaaatagg
tcgcaaaacattaaaacttttggcctttggggtaataatttgatggaaataacaaatcaaagatgtttattattttgtga
catactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcataagttttatatgattgtaacataata
tgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatgtatgacacgctgtgcatgg
gatgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggtt
gtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaatttaggaacagtagtgctggagggggtca
taataatgatcataacgagggtgtagacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EU500468.1-LFY1030
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctacatgctctctcccaagaaggtactatgaatattatttaccctt
gtgtcttatattaaccgtagtatataggcatacaggtagggtttgattacactttgaaataacattattttacatgtaaa
ttaatagtgcgacaaaataacatgttcaaacagatgataaaaaaaaattagaatttagtgaatcaaagaagaaaaatagg
tcgcaaaacattaaaacttttggcctttggggtaataatttgatggaaataacaaatcaaagatgtttattattttgtga
catactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcataagttttatatgattgtaacataata
tgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatgtatgacacgctgtgcatgg
gatgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggtt
gtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaatttaggaacagtagtgctggagggggtca
taataatgatcataacgagggtgtagacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EU500467.1-LFY1030
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctacatgctctctcccaagaaggtactatgaatattatttaccctt
gtgtcttatattaaccgtagtatataggcatacaggtagggtttgattacactttgaaataacattattttacatgtaaa
ttaatagtgcgacaaaataacatgttcaaacagatgataaaaaaaaattagaatttagtgaatcaaagaagaaaaatagg
tcgcaaaacattaaaacttttggcctttggggtaataatttgatggaaataacaaatcaaagatgtttattattttgtga
catactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcataagttttatatgattgtaacataata
tgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatgtatgacacgctgtgcatgg
gatgtgtagggctgtccgaggagccagtgcaacaagagaaggagatggtggggagcggagtagggatggcgtgggaggtt
gtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaatttaggaacagtagtgctggagggggtca
taataatgatcataacgagggtgtagacgacgacatggacgacatgaatgggcaggggaacggtggagga
back to top
>EU683940.1-LFY344
tggtgacggagccgggggaggtggcgcgtggcaaaatgaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaccattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagttttacccgtct
cccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtatgaagtccgtcaaatttcct
tttgcatttgtttactctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagc
tacatcaacaagcccaaaatgcgc
back to top
>EU683939.1-LFY344
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagttttacccrtct
cccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtatgaagtccgtcaaatttcct
tttgcatttgtttactctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagc
tacatcaacaaacccaaaatgcgc
back to top
>EF127063.1-LFY345
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagttttacccatc
tcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtatgaagtccgtcaaatttcc
ttttgcatttgtttactctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaagaaggcaggggcaag
ctacatcaacaarcccaaaatgcgc
back to top
>EF127062.1-LFY345
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaccattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagttttacccgtc
tcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtatgaagtccgtcaaatttcc
ttttgcatttgtttactctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaag
ctacatcaacaagcccaaaatgcgc
back to top
>EU500476.1-LFY.m1579
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaa
tttaggaacagtagtgctggagggggtcataataatgatcataacgagggtgtagacgacgacatggacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU500473.1-LFY.m1579
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttgtactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaa
tttaggaacagtagtgctggagggggtcataataatgatcataacgagggtgtagacgacgacatggacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU500472.1-LFY.m1579
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttgtactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaa
tttaggaacagtagtgctggagggggtcataataatgatcataacgagggtgtagacgacgacatggacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU500470.1-LFY.m1579
gaaccagccgtaacgccattagccgcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaaaacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaa
tttaggaacagtagtgctggagggggtcataataatgatcataacgagggtgtagacgacgacatggacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU500469.1-LFY.m1579
gaaccacccgtaacgccagtaccggcatctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgatcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctacatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaa
tttaggaacagtagtgctggagggggtcataataatgatcataacgagggtgtagacgacgacatggacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU500468.1-LFY.m1579
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctacatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaa
tttaggaacagtagtgctggagggggtcataataatgatcataacgagggtgtagacgacgacatggacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU500467.1-LFY.m1579
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacgacggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgataccaccaccaatgccctacatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaaacagcggaggatgaagaaggggcaa
tttaggaacagtagtgctggagggggtcataataatgatcataacgagggtgtagacgacgacatggacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU683940.1-LFY.m1209
tggtgacggagccgggggaggtggcgcgtggcaaaatgaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaccattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgtttag
gtatgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top
>EU683939.1-LFY.m1209
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgtttag
gtatgccaaaaaggcaggggcaagctacatcaacaaacccaaaatgcgc
back to top
>EF127063.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaagaaggcaggggcaagctacatcaacaarcccaaaatgcgc
back to top
>EF127062.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaccattgccaaggagcgcggtgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top