LFY, LFY (gene) Crataegus uniflora

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus uniflora
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500510.1-LFYCrataegus unifloragene
LFYEU683951.1-LFYCrataegus unifloragene
LFYEF127057.1-LFYCrataegus unifloragene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500510.1-LFY.m1Crataegus unifloramRNA
LFYEU683951.1-LFY.m1Crataegus unifloramRNA
LFYEF127057.1-LFY.m1Crataegus unifloramRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus unifloragene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500510.1-LFY N/A EU500510.1
gene parsed from NCBI nr database EU683951.1-LFY N/A EU683951.1
gene parsed from NCBI nr database EF127057.1-LFY N/A EF127057.1
mRNA parsed from NCBI nr database EU500510.1-LFY.m1 N/A EU500510.1
mRNA parsed from NCBI nr database EU683951.1-LFY.m1 N/A EU683951.1
mRNA parsed from NCBI nr database EF127057.1-LFY.m1 N/A EF127057.1

Sequence(s):
>EU500510.1-LFY1048
gaagcagccgtaacgccagtaccggcatctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagataccggagcttggatttactg
tgaacaccctcttggacatgaaggatcatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgatgccaccaccaatgccctacatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttacatgtaaattaatagtgtgacaatataacatgttcaaacagatgataaaaaagaattagaatttagtgaa
tcaaagaagaaaaatagatcgcaaaacattaaaacttttggcctttggtgtaataatttgatggaaataacaaatcaaag
atgtttattattttgtgacatactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgtttta
tatgattgtaacataatatgtcaattatcgtagtctttgatactagaacataaagtagttgttatattagattgggatat
atgacacgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagta
gggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactg
tagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatgaatgggcaggggaacg
gtggagga
back to top
>EU683951.1-LFY418
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtttttacccatc
tcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtacgaagtccgtcaaatttac
catttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatgtataatttcgttttgca
tttgtttactgtttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatc
aacaaacccaaaatgagc
back to top
>EF127057.1-LFY419
atggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtttttacccat
ctcccctctttacgtacgctgatttctactgtggcaattaattaacagtaaaaattcttgtacgaagtccgtcaaattta
ccatttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatgtataatttcgttttgc
atttgtttactgtttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacat
caacaaacccaaaatgagc
back to top
>EU500510.1-LFY.m1579
gaagcagccgtaacgccagtaccggcatctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagataccggagcttggatttactg
tgaacaccctcttggacatgaaggatcatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgatgccaccaccaatgccctacatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatgaatgg
gcaggggaacggtggagga
back to top
>EU683951.1-LFY.m1209
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccgc
gatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaaccaagtgtttag
gtatgccaaaaaggcaggggcaagctacatcaacaaacccaaaatgagc
back to top
>EF127057.1-LFY.m1210
atggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaaacccaaaatgagc
back to top