LFY, LFY (gene) Crataegus viridis

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Crataegus viridis
Synonym LEAFY protein
LEAFY
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500487.1-LFYCrataegus viridisgene
LFYEU683950.1-LFYCrataegus viridisgene
LFYEF127050.1-LFYCrataegus viridisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYEU500487.1-LFY.m1Crataegus viridismRNA
LFYEU683950.1-LFY.m1Crataegus viridismRNA
LFYEF127050.1-LFY.m1Crataegus viridismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYCrataegus viridisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU500487.1-LFY N/A EU500487.1
gene parsed from NCBI nr database EU683950.1-LFY N/A EU683950.1
gene parsed from NCBI nr database EF127050.1-LFY N/A EF127050.1
mRNA parsed from NCBI nr database EU500487.1-LFY.m1 N/A EU500487.1
mRNA parsed from NCBI nr database EU683950.1-LFY.m1 N/A EU683950.1
mRNA parsed from NCBI nr database EF127050.1-LFY.m1 N/A EF127050.1

Sequence(s):
>EU500487.1-LFY1057
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgatatcaccaccaatgccctagatgctctctcccaagaaggtactatacgctatattatataca
tgaatattatttacccttatgtcttagattaaccgtagtatataggcatataggtagggtttgattacactttgaaataa
cattattttaaatgtaaattaatagtgtgacaatataacatgttcaaccagatgataaaaaagaattagaatttagtgaa
tcaaagaagaaaaataggtcgcaaaacattaaaacttttggcctttggtgtaataatttgatggacataacaaatcaaag
atgtttattattttgtgacatactatgccagatcataagatgttcgagattgcgtgataaaactaaaagcatatgtttta
tatgattgtaacattatatgtcaattatcgtagtctttgatagtagaacataaagtagttgttatattagattgggatat
atgacacgctgtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtggggagcggagta
gggatggagtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaatataggaactg
tagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacgatatgaacgggc
aggggaacggtggagga
back to top
>EU683950.1-LFY417
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcagtgccgc
gatttcttgatccaggtccagaacattgccaaggagcgmggcgaaaaatgtcccaccaaggtacgaagttttacccatct
cccctctttacgtacgctgatttctactgtggccattaattaacagtaaaaattcttgtatgaagtccgtcaaatttacc
atttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttggaacaaaatktataatttcgttttgcat
ttgtttactctttacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatca
acaagcccaagatgcgc
back to top
>EF127050.1-LFY442
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgaggcgaaaaatgtcccaccaaggtacgaagttttacccatc
tcccctctttacgtacgctgatttctactgtggccattaattaacagtaaaaattcttgtatgaagcccgtcaaatttac
catttcgtgtaccacatacataacgatctggtacaaggtattaacggaagttgaggtttagggatgtcctcgagttagaa
caaaatgtataatttcgttttgcatttgtttgctctttacattatatatgcaggtgacaaaccaagtgtttaggtatgcc
aaaaaggcaggggcaagctacatcaacaagcccaaratgcgc
back to top
>EU500487.1-LFY.m1588
gaagcagccgtaacgccagtagcggcagctgctgcggcggcggctggttatactttgcggccgccaagggagcttggact
tggagggcttgaagacttgttccaggcttatggggttagatactacacggcggcgaagatagcggagcttggatttactg
tgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagttg
cttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggactctcggcggcg
caaccttgtctctggtgatatcaccaccaatgccctagatgctctctcccaagaagtgcaacaagagaaggagatggtgg
ggagcggagtagggatggagtgggaggttgtgacggcgggggagaggcggaagaagcagcggaggatgaagaaggggcaa
tataggaactgtagtgctggagggggtcataataatgatcataacgagggtgtagacgacaaggacgacgacatggacga
tatgaacgggcaggggaacggtggagga
back to top
>EU683950.1-LFY.m1191
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcagtgccgc
gatttcttgatccaggtccagaacattgccaaggagcgmggcgaaaaatgtcccaccaaggtgtatgccaaaaaggcagg
ggcaagctacatcaacaagcccaagatgcgc
back to top
>EF127050.1-LFY.m1210
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgattacctcttccatctctacgagcaatgccg
cgatttcttgatccaggtccagaacattgccaaggagcgaggcgaaaaatgtcccaccaaggtgacaaaccaagtgttta
ggtatgccaaaaaggcaggggcaagctacatcaacaagcccaaratgcgc
back to top