LFY, LFY (gene) Eriobotrya japonica

Gene Overview
Name LFY
Gene Symbol LFY
Type gene
Organism Eriobotrya japonica
Synonym transcriptional factor leafy
Description NA
Comment ej-lfy
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY551183.2-LFYEriobotrya japonicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
LFYAY551183.2-LFY.m1Eriobotrya japonicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
LEAFYLFYEriobotrya japonicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY551183.2-LFY N/A AY551183.2
mRNA parsed from NCBI nr database AY551183.2-LFY.m1 N/A AY551183.2

Sequence(s):
>AY551183.2-LFY2602
atggatccagatgccttctctgcgaacttgttcaagtgggacttacgtgggatggttgtgccgacgaaccgggttcagct
cgaagcagccgtgcctccagcagcggcagctgctgcgggggcggctggttatactttgcggccgccaagagagcttggac
ttagagggcttgaagacttgttccaggcttatggggtcagatactacacggcggcgaagatagcggagcttggatttact
gtgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagtt
gtttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggaccctcggcggc
gcaaccctgtctctggtgataccaccaccaatgccctagatgctctctcccaagaaggtactacacgctatatacatgaa
tattatttatctttgtgtcttagattaaccgtagtatataggcatatagttagggtttgattacactttgaaataacatt
attttacatgtaaattaatattttacatgtatattaatagtgtgacaatataacatattcaaatagatgataaaaaaaat
taggatttagagaatcaaagaagaaaaataggtcgcaaaacattaaaacttttggcctttggtttaataatttgatggaa
ataacaaatcaaagatgtttattattttgcaacatagtatgccagatcatatgatgttcgagattgcgtgacaaaactaa
aagcatatgttttatatgattgtaacataatatgccaattatcatagtctttgatactagaaacataaattagttgttat
attagatgggatgtatgatacgcggtgcatgggatgtgtagggctgtcggaggagccagtgcaacaagagaaggagatgg
ttgggagcggagtagggatggcgtgggaggtcgtgacggtgggggagaggcggaagaagcagcggaggatgaagaagggg
caatttaggaactgtagtgctggagggggtcatgatcataacgagggtgtagacgacaaggacgacgacatggacgacat
gaatgggcaggggaacggtggaggaggggggttgctaggcgagagacagagggagcacccgttcattgtgacggagcctg
gggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccgtgatttcttgatccag
gtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtacggagtttacccatgatttcatacgattatct
ttactgtggtaaatacagtaaactcatattagactcactgatccttgtgggcccatttcctctaagtacaattataaaat
agtgggcagtaataaatttttagttataacgagaatacagataatacaccaagtgttattatgccactaaaaaatctctc
cttgagtggttctttgtattatcacatttgatttctggacgtccatcaataaagaaaaagactcttatactcatatataa
aattaccacaaagacttggtgattgtctaagaaaaacaattatagggttttttttcactgtattcacctcattgatgcac
cttgttgttatggtatgcactagaaacttaggtagttgaaccctaagcgttatatacacactcatttttacttctcatac
atcattctcaattcctagccatcgaatcgaatgaattgaagatcaatggaccaaaattaataagaatgtgtcagagataa
aaagaggtgtataaaaagcacgactaaaacacttctttccggttatgaacaacacattttcaatcatttagatttggcaa
agtttcatttatgcattttcaattacatcgaatttaatacatgcagtctgcaaattttgtcaatttaagaatatctgtca
actttcctgaatttctagtatgaaatctattaaatttatcctcttacaagaaatttacattgttgatgaatattctttga
atcggaactactttcttacattatgagtcaaatttgatgcattcgaaaatacatgaatgaaagtaggtcagtttgtagtc
caaattaatttgattcaactacttagttcgactaatttaatttcacacttttttactacaaacattatatatgcaggtga
caaaccaggtgtttaggtatgccaaaaagtcaggcgcaagctacatcaacaagccgaagatgcggcactatgtgcactgc
tacgccttgcattgcctggacgtggaggcgtcgaatgtgctgaggagagcgttcaaggagaggggggaaaatgttggggc
atggcggcaggcgtgttacaagcctcttgtggtcattgcagcaggccaaggctgggacatcgatgccattttcaattctc
atccccgtctctccatctggtacgttcccacgaagctccgtcagctttgtcacgccgagcgccacaatgcctccgcctct
agctctgcctccggtggtgggggcgagcacctgccctattga
back to top
>AY551183.2-LFY.m11227
atggatccagatgccttctctgcgaacttgttcaagtgggacttacgtgggatggttgtgccgacgaaccgggttcagct
cgaagcagccgtgcctccagcagcggcagctgctgcgggggcggctggttatactttgcggccgccaagagagcttggac
ttagagggcttgaagacttgttccaggcttatggggtcagatactacacggcggcgaagatagcggagcttggatttact
gtgaacaccctcttggacatgaaggatgatgagcttgatgacatgatgagcagcctctctcagatattccgctgggagtt
gtttgttggggagaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgaggaggaggaccctcggcggc
gcaaccctgtctctggtgataccaccaccaatgccctagatgctctctcccaagaagggctgtcggaggagccagtgcaa
caagagaaggagatggttgggagcggagtagggatggcgtgggaggtcgtgacggtgggggagaggcggaagaagcagcg
gaggatgaagaaggggcaatttaggaactgtagtgctggagggggtcatgatcataacgagggtgtagacgacaaggacg
acgacatggacgacatgaatgggcaggggaacggtggaggaggggggttgctaggcgagagacagagggagcacccgttc
attgtgacggagcctggggaggtggcacgtggcaaaaagaacggtcttgattacctcttccatctctacgagcagtgccg
tgatttcttgatccaggtccagaacattgccaaggagcgcggtgaaaaatgtccaaccaaggtgacaaaccaggtgttta
ggtatgccaaaaagtcaggcgcaagctacatcaacaagccgaagatgcggcactatgtgcactgctacgccttgcattgc
ctggacgtggaggcgtcgaatgtgctgaggagagcgttcaaggagaggggggaaaatgttggggcatggcggcaggcgtg
ttacaagcctcttgtggtcattgcagcaggccaaggctgggacatcgatgccattttcaattctcatccccgtctctcca
tctggtacgttcccacgaagctccgtcagctttgtcacgccgagcgccacaatgcctccgcctctagctctgcctccggt
ggtgggggcgagcacctgccctattga
back to top